EMAIL THIS PAGE TO A FRIEND

CPB2

carboxypeptidase B2 (plasma)

84 Gene Product Result for
Synonyms: CPU PCPB TAFI
UniProtKB ID: Q96IY4, A8K464, Q15114, Q5T9K1, Q5T9K2, Q9P2Y6
Gene ID:
Human(1361) Summary: Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(56373) carboxypeptidase B2 (plasma)
Rat(113936) carboxypeptidase B2 (plasma)
sheep(101112329) carboxypeptidase B2 (plasma)
naked mole-rat(101712343) carboxypeptidase B2 (plasma)
domestic guinea pig(100736054) carboxypeptidase B2 (plasma)
Zebrafish(100000935) carboxypeptidase B2 (plasma)
chicken(418851) carboxypeptidase B2 (plasma)
domestic cat(101082116) carboxypeptidase B2 (plasma)
cow(508222) carboxypeptidase B2 (plasma)
dog(608910) carboxypeptidase B2 (plasma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001872 Rosetta Predictions human pricing
NM_016413 Rosetta Predictions human pricing
NM_053617 Rosetta Predictions rat pricing
NM_019775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026147 predicted 973
2 SASI_Hs02_00332710 predicted 305
3 SASI_Hs02_00332711 predicted 431
4 SASI_Hs02_00332712 predicted 367
5 SASI_Hs02_00332713 predicted 230
6 SASI_Hs02_00332714 predicted 976
7 SASI_Hs02_00332715 predicted 411
8 SASI_Hs02_00332716 predicted 407
9 SASI_Hs02_00332717 predicted 412
10 SASI_Hs02_00332718 predicted 351
11 SASI_Hs01_00026148 predicted 1033
12 SASI_Hs01_00026149 predicted 607
13 SASI_Hs01_00026150 predicted 742
14 SASI_Hs01_00026151 predicted 569
15 SASI_Hs01_00026152 predicted 546
16 SASI_Hs01_00026153 predicted 684
17 SASI_Hs01_00026154 predicted 424
18 SASI_Hs01_00026155 predicted 867
19 SASI_Hs01_00026156 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018284 predicted 860
2 SASI_Hs02_00349434 predicted 304
3 SASI_Hs02_00349435 predicted 426
4 SASI_Hs02_00349436 predicted 373
5 SASI_Hs02_00349437 predicted 239
6 SASI_Hs02_00349438 predicted 868
7 SASI_Hs02_00349439 predicted 412
8 SASI_Hs02_00349440 predicted 410
9 SASI_Hs02_00349441 predicted 415
10 SASI_Hs02_00349442 predicted 348
11 SASI_Hs01_00018285 predicted 923
12 SASI_Hs01_00018286 predicted 632
13 SASI_Hs01_00018287 predicted 569
14 SASI_Hs01_00018288 predicted 554
15 SASI_Hs01_00018289 predicted 417
16 SASI_Hs01_00018290 predicted 749
17 SASI_Hs01_00018291 predicted 983
18 SASI_Hs01_00018292 predicted 268
19 SASI_Hs01_00018293 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054024 predicted 928
2 SASI_Rn01_00054025 predicted 401
3 SASI_Rn01_00054026 predicted 1132
4 SASI_Rn01_00054027 predicted 499
5 SASI_Rn01_00054028 predicted 381
6 SASI_Rn01_00054029 predicted 417
7 SASI_Rn01_00054030 predicted 673
8 SASI_Rn02_00266321 predicted 745
9 SASI_Rn02_00266322 predicted 1184
10 SASI_Rn01_00054032 predicted 522
11 SASI_Rn01_00054031 predicted 230
12 SASI_Rn01_00054033 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152454 predicted 1095
2 SASI_Mm02_00324975 predicted 373
3 SASI_Mm01_00152455 predicted 336
4 SASI_Mm02_00324976 predicted 977
5 SASI_Mm01_00152457 predicted 1232
6 SASI_Mm01_00152459 predicted 902
7 SASI_Mm01_00152460 predicted 736
8 SASI_Mm01_00152461 predicted 644
9 SASI_Mm01_00152462 predicted 986
10 SASI_Mm01_00152463 predicted 754
11 SASI_Mm01_00152456 predicted 1209
12 SASI_Mm01_00152458 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001872
CPB2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase B2 (plasma)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-1025s21c1
Sequence:CCGGTATTCCTATACACGAAGTAAACTCGAGTTTACTTCGTGTATAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-642s21c1
Sequence:CCGGTGTGGTTCATAGGCCATATAACTCGAGTTATATGGCCTATGAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-672s21c1
Sequence:CCGGATGGGATAATAGGGCAATATACTCGAGTATATTGCCCTATTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001872.2-1432s1c1
Sequence:CCGGGAACCTAATAAGTGCTACTTTCTCGAGAAAGTAGCACTTATTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-747s1c1
Sequence:CCGGCCGTTCTTTCTATGCGAACAACTCGAGTTGTTCGCATAGAAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-372s1c1
Sequence:CCGGCGCATCGTACTATGAACAGTACTCGAGTACTGTTCATAGTACGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-441s1c1
Sequence:CCGGGCATCCTGATATGCTTACAAACTCGAGTTTGTAAGCATATCAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-199s1c1
Sequence:CCGGGCTGACCTTATTGTGAAGAAACTCGAGTTTCTTCACAATAAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001872
CPB2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase B2 (plasma)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-1025s21c1
Sequence:CCGGTATTCCTATACACGAAGTAAACTCGAGTTTACTTCGTGTATAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-642s21c1
Sequence:CCGGTGTGGTTCATAGGCCATATAACTCGAGTTATATGGCCTATGAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-672s21c1
Sequence:CCGGATGGGATAATAGGGCAATATACTCGAGTATATTGCCCTATTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001872.2-1432s1c1
Sequence:CCGGGAACCTAATAAGTGCTACTTTCTCGAGAAAGTAGCACTTATTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-747s1c1
Sequence:CCGGCCGTTCTTTCTATGCGAACAACTCGAGTTGTTCGCATAGAAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-372s1c1
Sequence:CCGGCGCATCGTACTATGAACAGTACTCGAGTACTGTTCATAGTACGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-441s1c1
Sequence:CCGGGCATCCTGATATGCTTACAAACTCGAGTTTGTAAGCATATCAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-199s1c1
Sequence:CCGGGCTGACCTTATTGTGAAGAAACTCGAGTTTCTTCACAATAAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001872
CPB2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase B2 (plasma)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-1025s21c1
Sequence:CCGGTATTCCTATACACGAAGTAAACTCGAGTTTACTTCGTGTATAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-642s21c1
Sequence:CCGGTGTGGTTCATAGGCCATATAACTCGAGTTATATGGCCTATGAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001872.3-672s21c1
Sequence:CCGGATGGGATAATAGGGCAATATACTCGAGTATATTGCCCTATTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001872.2-1432s1c1
Sequence:CCGGGAACCTAATAAGTGCTACTTTCTCGAGAAAGTAGCACTTATTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-747s1c1
Sequence:CCGGCCGTTCTTTCTATGCGAACAACTCGAGTTGTTCGCATAGAAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-372s1c1
Sequence:CCGGCGCATCGTACTATGAACAGTACTCGAGTACTGTTCATAGTACGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-441s1c1
Sequence:CCGGGCATCCTGATATGCTTACAAACTCGAGTTTGTAAGCATATCAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001872.2-199s1c1
Sequence:CCGGGCTGACCTTATTGTGAAGAAACTCGAGTTTCTTCACAATAAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019775
CPB2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase B2 (plasma)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-527s1c1
Sequence:CCGGCGGATCATCATTCGAGAAGTACTCGAGTACTTCTCGAATGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-1007s1c1
Sequence:CCGGGCACTCATACTCCCAACAAATCTCGAGATTTGTTGGGAGTATGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-255s1c1
Sequence:CCGGGCTGAATTCATCGAGAAGAAACTCGAGTTTCTTCTCGATGAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-957s1c1
Sequence:CCGGGCTGACTTCTTGAGAAGAAATCTCGAGATTTCTTCTCAAGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-311s1c1
Sequence:CCGGCGACAGTGTCAAAGCGCATTTCTCGAGAAATGCGCTTTGACACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019775
CPB2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase B2 (plasma)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-527s1c1
Sequence:CCGGCGGATCATCATTCGAGAAGTACTCGAGTACTTCTCGAATGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-1007s1c1
Sequence:CCGGGCACTCATACTCCCAACAAATCTCGAGATTTGTTGGGAGTATGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-255s1c1
Sequence:CCGGGCTGAATTCATCGAGAAGAAACTCGAGTTTCTTCTCGATGAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-957s1c1
Sequence:CCGGGCTGACTTCTTGAGAAGAAATCTCGAGATTTCTTCTCAAGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-311s1c1
Sequence:CCGGCGACAGTGTCAAAGCGCATTTCTCGAGAAATGCGCTTTGACACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019775
CPB2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase B2 (plasma)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-527s1c1
Sequence:CCGGCGGATCATCATTCGAGAAGTACTCGAGTACTTCTCGAATGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-1007s1c1
Sequence:CCGGGCACTCATACTCCCAACAAATCTCGAGATTTGTTGGGAGTATGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-255s1c1
Sequence:CCGGGCTGAATTCATCGAGAAGAAACTCGAGTTTCTTCTCGATGAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-957s1c1
Sequence:CCGGGCTGACTTCTTGAGAAGAAATCTCGAGATTTCTTCTCAAGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019775.2-311s1c1
Sequence:CCGGCGACAGTGTCAAAGCGCATTTCTCGAGAAATGCGCTTTGACACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks