EMAIL THIS PAGE TO A FRIEND

CPD

carboxypeptidase D

56 Gene Product Result for
Synonyms: GP180
Gene ID:
Human(1362) Summary: The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Mouse(12874) carboxypeptidase D
Rat(25306) carboxypeptidase D
Thale Cress(830453) cytochrome P450 90A1
dog(480636) carboxypeptidase D
Horse(100072234) carboxypeptidase D
cow(532189) carboxypeptidase D
domestic cat(101081771) carboxypeptidase D
chicken(417590) carboxypeptidase D
domestic guinea pig(100716995) carboxypeptidase D
naked mole-rat(101707145) carboxypeptidase D
sheep(101122802) carboxypeptidase D
Domestic Rabbit(100339843) carboxypeptidase D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001304 Rosetta Predictions human pricing
NM_012836 Rosetta Predictions rat pricing
NM_007754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134160 predicted 2858
2 SASI_Hs01_00134161 predicted 1289
3 SASI_Hs02_00331579 predicted 2356
4 SASI_Hs02_00331580 predicted 1896
5 SASI_Hs01_00134163 predicted 1828
6 SASI_Hs02_00331581 predicted 3933
7 SASI_Hs02_00331582 predicted 1328
8 SASI_Hs01_00134165 predicted 3951
9 SASI_Hs01_00134166 predicted 3064
10 SASI_Hs01_00134167 predicted 1808
11 SASI_Hs01_00134162 predicted 2814
12 SASI_Hs01_00134164 predicted 3987
13 SASI_Hs01_00134168 predicted 3627
14 SASI_Hs01_00134169 predicted 2362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031791 predicted 1926
2 SASI_Rn01_00031792 predicted 1356
3 SASI_Rn01_00031793 predicted 1350
4 SASI_Rn01_00031795 predicted 1601
5 SASI_Rn01_00031796 predicted 2286
6 SASI_Rn02_00260303 predicted 3690
7 SASI_Rn01_00031797 predicted 2835
8 SASI_Rn01_00031798 predicted 2528
9 SASI_Rn01_00031799 predicted 2068
10 SASI_Rn01_00031800 predicted 1885
11 SASI_Rn01_00031794 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108310 predicted 3542
2 SASI_Mm02_00312375 predicted 1918
3 SASI_Mm01_00108312 predicted 1885
4 SASI_Mm01_00108313 predicted 4003
5 SASI_Mm01_00108314 predicted 1764
6 SASI_Mm01_00108315 predicted 3713
7 SASI_Mm01_00108316 predicted 2192
8 SASI_Mm01_00108317 predicted 2872
9 SASI_Mm01_00108318 predicted 3667
10 SASI_Mm01_00108319 predicted 3789
11 SASI_Mm01_00108311 predicted 2057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007754
VALIDATED
CPD MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-872s1c1
Sequence:CCGGCCTCCGATGATGAAGTCTTTACTCGAGTAAAGACTTCATCATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-3043s1c1
Sequence:CCGGGCAGAATTTCTTTGCCTGAATCTCGAGATTCAGGCAAAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-763s1c1
Sequence:CCGGCGCAGGAACAAGTTTGTGCTTCTCGAGAAGCACAAACTTGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-2712s1c1
Sequence:CCGGCGACCCAACTTCTAAGGAGTTCTCGAGAACTCCTTAGAAGTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-2465s1c1
Sequence:CCGGCCCTCAGTGTTGCTGAAATTACTCGAGTAATTTCAGCAACACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-1332s21c1
Sequence:CCGGGGCGCTTTCAACTGGGTATATCTCGAGATATACCCAGTTGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-775s21c1
Sequence:CCGGCGCAGGAACAAGTTTGTGCTTCTCGAGAAGCACAAACTTGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-2477s21c1
Sequence:CCGGCCCTCAGTGTTGCTGAAATTACTCGAGTAATTTCAGCAACACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-884s21c1
Sequence:CCGGCCTCCGATGATGAAGTCTTTACTCGAGTAAAGACTTCATCATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007754
VALIDATED
CPD MISSION shRNA shRNA Plasmid DNA
carboxypeptidase D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-872s1c1
Sequence:CCGGCCTCCGATGATGAAGTCTTTACTCGAGTAAAGACTTCATCATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-3043s1c1
Sequence:CCGGGCAGAATTTCTTTGCCTGAATCTCGAGATTCAGGCAAAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-763s1c1
Sequence:CCGGCGCAGGAACAAGTTTGTGCTTCTCGAGAAGCACAAACTTGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-2712s1c1
Sequence:CCGGCGACCCAACTTCTAAGGAGTTCTCGAGAACTCCTTAGAAGTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-2465s1c1
Sequence:CCGGCCCTCAGTGTTGCTGAAATTACTCGAGTAATTTCAGCAACACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-1332s21c1
Sequence:CCGGGGCGCTTTCAACTGGGTATATCTCGAGATATACCCAGTTGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-775s21c1
Sequence:CCGGCGCAGGAACAAGTTTGTGCTTCTCGAGAAGCACAAACTTGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-2477s21c1
Sequence:CCGGCCCTCAGTGTTGCTGAAATTACTCGAGTAATTTCAGCAACACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-884s21c1
Sequence:CCGGCCTCCGATGATGAAGTCTTTACTCGAGTAAAGACTTCATCATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007754
VALIDATED
CPD MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-872s1c1
Sequence:CCGGCCTCCGATGATGAAGTCTTTACTCGAGTAAAGACTTCATCATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-3043s1c1
Sequence:CCGGGCAGAATTTCTTTGCCTGAATCTCGAGATTCAGGCAAAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-763s1c1
Sequence:CCGGCGCAGGAACAAGTTTGTGCTTCTCGAGAAGCACAAACTTGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-2712s1c1
Sequence:CCGGCGACCCAACTTCTAAGGAGTTCTCGAGAACTCCTTAGAAGTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007754.1-2465s1c1
Sequence:CCGGCCCTCAGTGTTGCTGAAATTACTCGAGTAATTTCAGCAACACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-1332s21c1
Sequence:CCGGGGCGCTTTCAACTGGGTATATCTCGAGATATACCCAGTTGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-775s21c1
Sequence:CCGGCGCAGGAACAAGTTTGTGCTTCTCGAGAAGCACAAACTTGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-2477s21c1
Sequence:CCGGCCCTCAGTGTTGCTGAAATTACTCGAGTAATTTCAGCAACACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007754.2-884s21c1
Sequence:CCGGCCTCCGATGATGAAGTCTTTACTCGAGTAAAGACTTCATCATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001304
VALIDATED
CPD MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-1587s1c1
Sequence:CCGGCCGGCTTTATTCCTTGGGAAACTCGAGTTTCCCAAGGAATAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-957s1c1
Sequence:CCGGCGAGACTTTCAAAGATGGAATCTCGAGATTCCATCTTTGAAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-4180s1c1
Sequence:CCGGCCAGCATAAGTACCAAGCAAACTCGAGTTTGCTTGGTACTTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-3690s1c1
Sequence:CCGGGCCAATCTCTAAAGCAGTCATCTCGAGATGACTGCTTTAGAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-2900s1c1
Sequence:CCGGGCACTGAATATCGTCACATTTCTCGAGAAATGTGACGATATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001304.3-1906s21c1
Sequence:CCGGTTTGACCTGAACCGAAATTTCCTCGAGGAAATTTCGGTTCAGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001304.3-4556s21c1
Sequence:CCGGAGCAGTCAGAATCGACATAAACTCGAGTTTATGTCGATTCTGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001304.3-668s21c1
Sequence:CCGGGAAGCTTTCCCGACCAGTTTACTCGAGTAAACTGGTCGGGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001304
VALIDATED
CPD MISSION shRNA shRNA Plasmid DNA
carboxypeptidase D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-1587s1c1
Sequence:CCGGCCGGCTTTATTCCTTGGGAAACTCGAGTTTCCCAAGGAATAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-957s1c1
Sequence:CCGGCGAGACTTTCAAAGATGGAATCTCGAGATTCCATCTTTGAAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-4180s1c1
Sequence:CCGGCCAGCATAAGTACCAAGCAAACTCGAGTTTGCTTGGTACTTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-3690s1c1
Sequence:CCGGGCCAATCTCTAAAGCAGTCATCTCGAGATGACTGCTTTAGAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-2900s1c1
Sequence:CCGGGCACTGAATATCGTCACATTTCTCGAGAAATGTGACGATATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001304.3-1906s21c1
Sequence:CCGGTTTGACCTGAACCGAAATTTCCTCGAGGAAATTTCGGTTCAGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001304.3-4556s21c1
Sequence:CCGGAGCAGTCAGAATCGACATAAACTCGAGTTTATGTCGATTCTGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001304.3-668s21c1
Sequence:CCGGGAAGCTTTCCCGACCAGTTTACTCGAGTAAACTGGTCGGGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001304
VALIDATED
CPD MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-1587s1c1
Sequence:CCGGCCGGCTTTATTCCTTGGGAAACTCGAGTTTCCCAAGGAATAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-957s1c1
Sequence:CCGGCGAGACTTTCAAAGATGGAATCTCGAGATTCCATCTTTGAAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-4180s1c1
Sequence:CCGGCCAGCATAAGTACCAAGCAAACTCGAGTTTGCTTGGTACTTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-3690s1c1
Sequence:CCGGGCCAATCTCTAAAGCAGTCATCTCGAGATGACTGCTTTAGAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001304.3-2900s1c1
Sequence:CCGGGCACTGAATATCGTCACATTTCTCGAGAAATGTGACGATATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001304.3-1906s21c1
Sequence:CCGGTTTGACCTGAACCGAAATTTCCTCGAGGAAATTTCGGTTCAGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001304.3-4556s21c1
Sequence:CCGGAGCAGTCAGAATCGACATAAACTCGAGTTTATGTCGATTCTGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001304.3-668s21c1
Sequence:CCGGGAAGCTTTCCCGACCAGTTTACTCGAGTAAACTGGTCGGGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks