EMAIL THIS PAGE TO A FRIEND

CPE

carboxypeptidase E

UniProtKB ID: P16870, A8K4N1, B3KR42, B4DFN4, D3DP33, Q9UIU9
Gene ID:
Human(1363) Summary: This gene encodes a carboxypeptidase that cleaves C-terminal amino acid residues and is involved in the biosynthesis of peptide hormones and neurotransmitters, including insulin. It is a peripheral membrane protein. The protein specifically binds regulated secretory pathway proteins, including prohormones, but not constitutively secreted proteins. Mutations in this gene are implicated in type II diabetes. [provided by RefSeq, Jul 2008]
Mouse(12876) carboxypeptidase E
Rat(25669) carboxypeptidase E
Zebrafish(407979) carboxypeptidase E
dog(475492) carboxypeptidase E
domestic cat(101080963) carboxypeptidase E
chicken(422424) carboxypeptidase E
cow(280753) carboxypeptidase E
sheep(443028) carboxypeptidase E
naked mole-rat(101719011) carboxypeptidase E
domestic guinea pig(100721385) carboxypeptidase E
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108657 Anti-CPE affinity isolated antibody guinea pig, rat, bovine, yeast, zebrafish, human, mouse
immunohistochemistry, western blot pricing
SAB2100472 Anti-CPE antibody produced in rabbit affinity isolated antibody mouse, pig, bovine, zebrafish, rat, rabbit, human, guinea pig
western blot pricing
SAB2700907 Anti-CPE antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
HPA003819 Anti-CPE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500431 Anti-CPE antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001873 siRNAs that have been validated in the lab human pricing
NM_013128 Rosetta Predictions rat pricing
XM_001074218 Rosetta Predictions rat pricing
NM_013494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001873 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156437 validated 851
1 SASI_Hs01_00156438 validated 1493
1 SASI_Hs01_00156439 validated 611
2 SASI_Hs02_00332719 predicted 965
3 SASI_Hs01_00156440 predicted 706
4 SASI_Hs01_00156442 predicted 614
5 SASI_Hs01_00156443 predicted 965
6 SASI_Hs01_00156444 predicted 1498
7 SASI_Hs02_00332720 predicted 1307
8 SASI_Hs01_00156446 predicted 1462
9 SASI_Hs02_00332721 predicted 972
10 SASI_Hs01_00156441 predicted 713
11 SASI_Hs01_00156445 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062093 predicted 846
2 SASI_Rn01_00062094 predicted 638
3 SASI_Rn01_00062096 predicted 541
4 SASI_Rn02_00260911 predicted 1588
5 SASI_Rn01_00062097 predicted 790
6 SASI_Rn01_00062099 predicted 398
7 SASI_Rn02_00260912 predicted 496
8 SASI_Rn01_00062100 predicted 855
9 SASI_Rn01_00062101 predicted 1176
10 SASI_Rn02_00260913 predicted 687
11 SASI_Rn01_00062095 predicted 1525
12 SASI_Rn01_00062098 predicted 668
13 SASI_Rn01_00062102 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345413 predicted 207
2 SASI_Rn02_00345414 predicted 206
3 SASI_Rn02_00345415 predicted 136
4 SASI_Rn02_00345416 predicted 247
5 SASI_Rn02_00345417 predicted 261
6 SASI_Rn02_00345418 predicted 176
7 SASI_Rn02_00345419 predicted 185
8 SASI_Rn02_00345420 predicted 186
9 SASI_Rn02_00345421 predicted 14
10 SASI_Rn02_00345422 predicted 182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069772 predicted 1591
2 SASI_Mm01_00069773 predicted 631
3 SASI_Mm01_00069774 predicted 805
4 SASI_Mm01_00069775 predicted 1325
5 SASI_Mm02_00322137 predicted 473
6 SASI_Mm01_00069776 predicted 786
7 SASI_Mm01_00069777 predicted 1546
8 SASI_Mm01_00069778 predicted 499
9 SASI_Mm01_00069779 predicted 536
10 SASI_Mm01_00069780 predicted 1097
11 SASI_Mm01_00069781 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013494
VALIDATED
CPE MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase E
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-674s21c1
Sequence:CCGGGACAGGATCGTGTATGTTAATCTCGAGATTAACATACACGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-394s21c1
Sequence:CCGGGCCGGGTGAACCTGAATTTAACTCGAGTTAAATTCAGGTTCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-946s21c1
Sequence:CCGGCTCTTCTTTCAACCCAGTCATCTCGAGATGACTGGGTTGAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-475s21c1
Sequence:CCGGCCAGTACCTGTGTAACGAGTACTCGAGTACTCGTTACACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-1334s21c1
Sequence:CCGGGCTCCTGGAAACTATAAACTTCTCGAGAAGTTTATAGTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-1334s1c1
Sequence:CCGGGCTCCTGGAAACTATAAACTTCTCGAGAAGTTTATAGTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-394s1c1
Sequence:CCGGGCCGGGTGAACCTGAATTTAACTCGAGTTAAATTCAGGTTCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-475s1c1
Sequence:CCGGCCAGTACCTGTGTAACGAGTACTCGAGTACTCGTTACACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-946s1c1
Sequence:CCGGCTCTTCTTTCAACCCAGTCATCTCGAGATGACTGGGTTGAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-674s1c1
Sequence:CCGGGACAGGATCGTGTATGTTAATCTCGAGATTAACATACACGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013494
VALIDATED
CPE MISSION shRNA shRNA Plasmid DNA
carboxypeptidase E
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-674s21c1
Sequence:CCGGGACAGGATCGTGTATGTTAATCTCGAGATTAACATACACGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-394s21c1
Sequence:CCGGGCCGGGTGAACCTGAATTTAACTCGAGTTAAATTCAGGTTCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-946s21c1
Sequence:CCGGCTCTTCTTTCAACCCAGTCATCTCGAGATGACTGGGTTGAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-475s21c1
Sequence:CCGGCCAGTACCTGTGTAACGAGTACTCGAGTACTCGTTACACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-1334s21c1
Sequence:CCGGGCTCCTGGAAACTATAAACTTCTCGAGAAGTTTATAGTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-1334s1c1
Sequence:CCGGGCTCCTGGAAACTATAAACTTCTCGAGAAGTTTATAGTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-394s1c1
Sequence:CCGGGCCGGGTGAACCTGAATTTAACTCGAGTTAAATTCAGGTTCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-475s1c1
Sequence:CCGGCCAGTACCTGTGTAACGAGTACTCGAGTACTCGTTACACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-946s1c1
Sequence:CCGGCTCTTCTTTCAACCCAGTCATCTCGAGATGACTGGGTTGAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-674s1c1
Sequence:CCGGGACAGGATCGTGTATGTTAATCTCGAGATTAACATACACGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013494
VALIDATED
CPE MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase E
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-674s21c1
Sequence:CCGGGACAGGATCGTGTATGTTAATCTCGAGATTAACATACACGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-394s21c1
Sequence:CCGGGCCGGGTGAACCTGAATTTAACTCGAGTTAAATTCAGGTTCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-946s21c1
Sequence:CCGGCTCTTCTTTCAACCCAGTCATCTCGAGATGACTGGGTTGAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-475s21c1
Sequence:CCGGCCAGTACCTGTGTAACGAGTACTCGAGTACTCGTTACACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013494.3-1334s21c1
Sequence:CCGGGCTCCTGGAAACTATAAACTTCTCGAGAAGTTTATAGTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-1334s1c1
Sequence:CCGGGCTCCTGGAAACTATAAACTTCTCGAGAAGTTTATAGTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-394s1c1
Sequence:CCGGGCCGGGTGAACCTGAATTTAACTCGAGTTAAATTCAGGTTCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-475s1c1
Sequence:CCGGCCAGTACCTGTGTAACGAGTACTCGAGTACTCGTTACACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-946s1c1
Sequence:CCGGCTCTTCTTTCAACCCAGTCATCTCGAGATGACTGGGTTGAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013494.2-674s1c1
Sequence:CCGGGACAGGATCGTGTATGTTAATCTCGAGATTAACATACACGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001873
VALIDATED
CPE MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase E
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-860s21c1
Sequence:CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001873.2-975s21c1
Sequence:CCGGTTCATTGGATTATGGATATTCCTCGAGGAATATCCATAATCCAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1474s21c1
Sequence:CCGGCCACGATGTTACATCCGCAAACTCGAGTTTGCGGATGTAACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1551s21c1
Sequence:CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1981s21c1
Sequence:CCGGATGCAATATTCCTGGTATTATCTCGAGATAATACCAGGAATATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001873.1-1136s1c1
Sequence:CCGGCCGGGCATACTCTTCTTTCAACTCGAGTTGAAAGAAGAGTATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-674s1c1
Sequence:CCGGCCAGTACCTATGCAACGAATACTCGAGTATTCGTTGCATAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-873s1c1
Sequence:CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-1487s1c1
Sequence:CCGGCCACGATGTTACATCCGCAAACTCGAGTTTGCGGATGTAACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-1564s1c1
Sequence:CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001873
VALIDATED
CPE MISSION shRNA shRNA Plasmid DNA
carboxypeptidase E
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-860s21c1
Sequence:CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001873.2-975s21c1
Sequence:CCGGTTCATTGGATTATGGATATTCCTCGAGGAATATCCATAATCCAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1474s21c1
Sequence:CCGGCCACGATGTTACATCCGCAAACTCGAGTTTGCGGATGTAACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1551s21c1
Sequence:CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1981s21c1
Sequence:CCGGATGCAATATTCCTGGTATTATCTCGAGATAATACCAGGAATATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001873.1-1136s1c1
Sequence:CCGGCCGGGCATACTCTTCTTTCAACTCGAGTTGAAAGAAGAGTATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-674s1c1
Sequence:CCGGCCAGTACCTATGCAACGAATACTCGAGTATTCGTTGCATAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-873s1c1
Sequence:CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-1487s1c1
Sequence:CCGGCCACGATGTTACATCCGCAAACTCGAGTTTGCGGATGTAACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-1564s1c1
Sequence:CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001873
VALIDATED
CPE MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase E
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-860s21c1
Sequence:CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001873.2-975s21c1
Sequence:CCGGTTCATTGGATTATGGATATTCCTCGAGGAATATCCATAATCCAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1474s21c1
Sequence:CCGGCCACGATGTTACATCCGCAAACTCGAGTTTGCGGATGTAACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1551s21c1
Sequence:CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001873.2-1981s21c1
Sequence:CCGGATGCAATATTCCTGGTATTATCTCGAGATAATACCAGGAATATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001873.1-1136s1c1
Sequence:CCGGCCGGGCATACTCTTCTTTCAACTCGAGTTGAAAGAAGAGTATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-674s1c1
Sequence:CCGGCCAGTACCTATGCAACGAATACTCGAGTATTCGTTGCATAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-873s1c1
Sequence:CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-1487s1c1
Sequence:CCGGCCACGATGTTACATCCGCAAACTCGAGTTTGCGGATGTAACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001873.1-1564s1c1
Sequence:CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks