EMAIL THIS PAGE TO A FRIEND

CPEB1

cytoplasmic polyadenylation element binding protein 1

226 Gene Product Result for
Synonyms: CEBP CPE-BP1 CPEB
UniProtKB ID: Q9BZB8, B7Z6C6, Q86W46, Q8IV41, Q9BZB7, Q9H8V5
Gene ID:
Human(64506) Summary: This gene encodes a member of the cytoplasmic polyadenylation element (CPE) binding protein family. This highly conserved protein binds to a specific RNA sequence called the CPE found in the 3' UTR of some mRNAs. Similar proteins in Xenopus and mouse function to induce cytoplasmic polyadenylation of dormant mRNAs with short polyA tails, resulting in their translation. Members of this protein family regulate translation of cyclin B1 during embryonic cell divisions. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12877) cytoplasmic polyadenylation element binding protein 1
Rat(293056) cytoplasmic polyadenylation element binding protein 1
domestic guinea pig(101788596) cytoplasmic polyadenylation element binding protein 1
naked mole-rat(101699004) cytoplasmic polyadenylation element binding protein 1
sheep(101110092) cytoplasmic polyadenylation element binding protein 1
Domestic Rabbit(100358916) cytoplasmic polyadenylation element binding protein 1
chicken(415326) cytoplasmic polyadenylation element binding protein 1
dog(100683974) cytoplasmic polyadenylation element binding protein 1
Horse(100068411) cytoplasmic polyadenylation element binding protein 1
cow(514174) cytoplasmic polyadenylation element binding protein 1
domestic cat(101098542) cytoplasmic polyadenylation element binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079533 Rosetta Predictions human pricing
NM_001079534 Rosetta Predictions human pricing
NM_001079535 Rosetta Predictions human pricing
NM_030594 Rosetta Predictions human pricing
NM_001106276 Rosetta Predictions rat pricing
NM_007755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313530 predicted 1584
2 SASI_Hs02_00313531 predicted 449
3 SASI_Hs02_00313532 predicted 1480
4 SASI_Hs02_00313533 predicted 1339
5 SASI_Hs02_00313534 predicted 1493
6 SASI_Hs02_00313535 predicted 1288
7 SASI_Hs02_00313536 predicted 587
8 SASI_Hs02_00313537 predicted 1338
9 SASI_Hs02_00313538 predicted 1416
10 SASI_Hs02_00313539 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313540 predicted 1563
2 SASI_Hs02_00313541 predicted 454
3 SASI_Hs02_00313542 predicted 1469
4 SASI_Hs02_00313543 predicted 1320
5 SASI_Hs02_00313544 predicted 1479
6 SASI_Hs02_00313545 predicted 1276
7 SASI_Hs02_00313546 predicted 591
8 SASI_Hs02_00313547 predicted 1318
9 SASI_Hs02_00313548 predicted 1404
10 SASI_Hs02_00313549 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313550 predicted 1667
2 SASI_Hs02_00313551 predicted 1569
3 SASI_Hs02_00313552 predicted 486
4 SASI_Hs02_00313553 predicted 1424
5 SASI_Hs02_00313554 predicted 1577
6 SASI_Hs02_00313555 predicted 1374
7 SASI_Hs02_00313556 predicted 687
8 SASI_Hs02_00313557 predicted 1425
9 SASI_Hs02_00313558 predicted 1506
10 SASI_Hs02_00313559 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358162 predicted 1671
2 SASI_Hs02_00358163 predicted 1581
3 SASI_Hs02_00358164 predicted 494
4 SASI_Hs02_00358165 predicted 1427
5 SASI_Hs02_00358166 predicted 1591
6 SASI_Hs02_00358167 predicted 1379
7 SASI_Hs02_00358168 predicted 689
8 SASI_Hs02_00358169 predicted 1430
9 SASI_Hs02_00358170 predicted 1505
10 SASI_Hs02_00358171 predicted 1621
11 SASI_Hs01_00151035 predicted 1546
12 SASI_Hs01_00151036 predicted 1383
13 SASI_Hs01_00151037 predicted 1393
14 SASI_Hs01_00151038 predicted 1765
15 SASI_Hs01_00151039 predicted 1895
16 SASI_Hs01_00151040 predicted 1721
17 SASI_Hs01_00151041 predicted 1841
18 SASI_Hs01_00151042 predicted 699
19 SASI_Hs01_00151043 predicted 1696
20 SASI_Hs01_00151044 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217378 predicted 1189
2 SASI_Rn02_00217379 predicted 1100
3 SASI_Rn02_00217380 predicted 1083
4 SASI_Rn02_00217381 predicted 1585
5 SASI_Rn02_00217382 predicted 1375
6 SASI_Rn02_00217383 predicted 397
7 SASI_Rn02_00217384 predicted 1088
8 SASI_Rn02_00217385 predicted 1553
9 SASI_Rn02_00217386 predicted 843
10 SASI_Rn02_00217387 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142829 predicted 1240
2 SASI_Mm01_00142830 predicted 1102
3 SASI_Mm01_00142831 predicted 1081
4 SASI_Mm01_00142832 predicted 1591
5 SASI_Mm01_00142833 predicted 1380
6 SASI_Mm01_00142834 predicted 1514
7 SASI_Mm01_00142835 predicted 399
8 SASI_Mm01_00142836 predicted 234
9 SASI_Mm01_00142837 predicted 1092
10 SASI_Mm01_00142838 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030594
CPEB1 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030594.2-1740s1c1
Sequence:CCGGCGTGTGACTTTCAATAACCAACTCGAGTTGGTTATTGAAAGTCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030594.2-405s1c1
Sequence:CCGGGCCAATATCTTTCGAAGGATACTCGAGTATCCTTCGAAAGATATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2425s1c1
Sequence:CCGGCGCAGGTCTCATTGGTTTCATCTCGAGATGAAACCAATGAGACCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2148s1c1
Sequence:CCGGGCACTTGCTGAATCTGTCTTTCTCGAGAAAGACAGATTCAGCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2426s1c1
Sequence:CCGGGCAGGTCTCATTGGTTTCATTCTCGAGAATGAAACCAATGAGACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030594.3-2147s21c1
Sequence:CCGGGATGCCTACACCTAGGTTTATCTCGAGATAAACCTAGGTGTAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030594.3-251s21c1
Sequence:CCGGAGTCTGCACTACACCTATAAACTCGAGTTTATAGGTGTAGTGCAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030594
CPEB1 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030594.2-1740s1c1
Sequence:CCGGCGTGTGACTTTCAATAACCAACTCGAGTTGGTTATTGAAAGTCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030594.2-405s1c1
Sequence:CCGGGCCAATATCTTTCGAAGGATACTCGAGTATCCTTCGAAAGATATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2425s1c1
Sequence:CCGGCGCAGGTCTCATTGGTTTCATCTCGAGATGAAACCAATGAGACCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2148s1c1
Sequence:CCGGGCACTTGCTGAATCTGTCTTTCTCGAGAAAGACAGATTCAGCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2426s1c1
Sequence:CCGGGCAGGTCTCATTGGTTTCATTCTCGAGAATGAAACCAATGAGACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030594.3-2147s21c1
Sequence:CCGGGATGCCTACACCTAGGTTTATCTCGAGATAAACCTAGGTGTAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030594.3-251s21c1
Sequence:CCGGAGTCTGCACTACACCTATAAACTCGAGTTTATAGGTGTAGTGCAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030594
CPEB1 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030594.2-1740s1c1
Sequence:CCGGCGTGTGACTTTCAATAACCAACTCGAGTTGGTTATTGAAAGTCACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030594.2-405s1c1
Sequence:CCGGGCCAATATCTTTCGAAGGATACTCGAGTATCCTTCGAAAGATATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2425s1c1
Sequence:CCGGCGCAGGTCTCATTGGTTTCATCTCGAGATGAAACCAATGAGACCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2148s1c1
Sequence:CCGGGCACTTGCTGAATCTGTCTTTCTCGAGAAAGACAGATTCAGCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030594.2-2426s1c1
Sequence:CCGGGCAGGTCTCATTGGTTTCATTCTCGAGAATGAAACCAATGAGACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030594.3-2147s21c1
Sequence:CCGGGATGCCTACACCTAGGTTTATCTCGAGATAAACCTAGGTGTAGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030594.3-251s21c1
Sequence:CCGGAGTCTGCACTACACCTATAAACTCGAGTTTATAGGTGTAGTGCAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007755
VALIDATED
CPEB1 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007755.1-2143s1c1
Sequence:CCGGGCCATACAGTGCCTTTCCATTCTCGAGAATGGAAAGGCACTGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007755.1-2219s1c1
Sequence:CCGGGTAACAAACAAAGGAGACTTTCTCGAGAAAGTCTCCTTTGTTTGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007755.4-172s21c1
Sequence:CCGGAGTCTGTACAACACCTATAAACTCGAGTTTATAGGTGTTGTACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007755.4-1862s21c1
Sequence:CCGGGTCTTTGTTTCTGCACTAATTCTCGAGAATTAGTGCAGAAACAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007755.4-1368s21c1
Sequence:CCGGCCATCTTGAATGACCTATTTGCTCGAGCAAATAGGTCATTCAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007755.4-627s21c1
Sequence:CCGGTGATTTCAAGCCTTCGCATTTCTCGAGAAATGCGAAGGCTTGAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007755.4-972s21c1
Sequence:CCGGGAGGCGTTCCTTGGGATATTACTCGAGTAATATCCCAAGGAACGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007755
VALIDATED
CPEB1 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007755.1-2143s1c1
Sequence:CCGGGCCATACAGTGCCTTTCCATTCTCGAGAATGGAAAGGCACTGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007755.1-2219s1c1
Sequence:CCGGGTAACAAACAAAGGAGACTTTCTCGAGAAAGTCTCCTTTGTTTGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007755.4-172s21c1
Sequence:CCGGAGTCTGTACAACACCTATAAACTCGAGTTTATAGGTGTTGTACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007755.4-1862s21c1
Sequence:CCGGGTCTTTGTTTCTGCACTAATTCTCGAGAATTAGTGCAGAAACAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007755.4-1368s21c1
Sequence:CCGGCCATCTTGAATGACCTATTTGCTCGAGCAAATAGGTCATTCAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007755.4-627s21c1
Sequence:CCGGTGATTTCAAGCCTTCGCATTTCTCGAGAAATGCGAAGGCTTGAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007755.4-972s21c1
Sequence:CCGGGAGGCGTTCCTTGGGATATTACTCGAGTAATATCCCAAGGAACGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007755
VALIDATED
CPEB1 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007755.1-2143s1c1
Sequence:CCGGGCCATACAGTGCCTTTCCATTCTCGAGAATGGAAAGGCACTGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007755.1-2219s1c1
Sequence:CCGGGTAACAAACAAAGGAGACTTTCTCGAGAAAGTCTCCTTTGTTTGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007755.4-172s21c1
Sequence:CCGGAGTCTGTACAACACCTATAAACTCGAGTTTATAGGTGTTGTACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007755.4-1862s21c1
Sequence:CCGGGTCTTTGTTTCTGCACTAATTCTCGAGAATTAGTGCAGAAACAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007755.4-1368s21c1
Sequence:CCGGCCATCTTGAATGACCTATTTGCTCGAGCAAATAGGTCATTCAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007755.4-627s21c1
Sequence:CCGGTGATTTCAAGCCTTCGCATTTCTCGAGAAATGCGAAGGCTTGAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007755.4-972s21c1
Sequence:CCGGGAGGCGTTCCTTGGGATATTACTCGAGTAATATCCCAAGGAACGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)