EMAIL THIS PAGE TO A FRIEND

CPEB2

cytoplasmic polyadenylation element binding protein 2

249 Gene Product Result for
Synonyms: CPE-BP2 CPEB-2 hCPEB-2
UniProtKB ID: Q7Z5Q1, Q3B8N6, Q3MI89, Q3MI90, Q3MI92, Q7Z5Q0
Gene ID:
Human(132864) Summary: The protein encoded by this gene is highly similar to cytoplasmic polyadenylation element binding protein (CPEB), an mRNA-binding protein that regulates cytoplasmic polyadenylation of mRNA as a trans factor in oogenesis and spermatogenesis. Studies of the similar gene in mice suggested a possible role of this protein in transcriptionally inactive haploid spermatids. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(231207) cytoplasmic polyadenylation element binding protein 2
Rat(360949) cytoplasmic polyadenylation element binding protein 2
Zebrafish(100330483) cytoplasmic polyadenylation element binding protein 2
chicken(422832) cytoplasmic polyadenylation element binding protein 2
domestic cat(101100808) cytoplasmic polyadenylation element binding protein 2
cow(538880) cytoplasmic polyadenylation element binding protein 2
Horse(100069076) cytoplasmic polyadenylation element binding protein 2
dog(488821) cytoplasmic polyadenylation element binding protein 2
sheep(101116316) cytoplasmic polyadenylation element binding protein 2
Domestic Rabbit(100351062) cytoplasmic polyadenylation element binding protein 2
naked mole-rat(101724060) cytoplasmic polyadenylation element binding protein 2
domestic guinea pig(100733662) cytoplasmic polyadenylation element binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41185 Anti-CPEB2 (AB1) antibody produced in rabbit affinity isolated antibody rat, horse, rabbit, pig, human, mouse, guinea pig
western blot pricing
AV41186 Anti-CPEB2 (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, mouse, rat
western blot pricing
SAB2107989 Anti-CPEB2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human, rat
western blot pricing
AV41187 Anti-CPEB2 antibody produced in rabbit IgG fraction of antiserum , bovine, rabbit, canine, pig, guinea pig, horse, human, mouse, rat, zebrafish
western blot pricing
HPA072513 Anti-CPEB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182485 Rosetta Predictions human pricing
NM_182646 Rosetta Predictions human pricing
NM_001108361 Rosetta Predictions rat pricing
NM_175937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065895 predicted 1316
2 SASI_Hs01_00065896 predicted 1247
3 SASI_Hs01_00065898 predicted 1331
4 SASI_Hs01_00065899 predicted 1341
5 SASI_Hs02_00370519 predicted 1931
6 SASI_Hs01_00065900 predicted 1294
7 SASI_Hs01_00065901 predicted 1117
8 SASI_Hs01_00065902 predicted 1721
9 SASI_Hs01_00065903 predicted 1322
10 SASI_Hs01_00065904 predicted 1783
11 SASI_Hs01_00065897 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048530 predicted 1231
2 SASI_Hs01_00048531 predicted 1156
3 SASI_Hs01_00048533 predicted 1243
4 SASI_Hs01_00048534 predicted 1257
5 SASI_Hs02_00370807 predicted 1840
6 SASI_Hs01_00048535 predicted 1204
7 SASI_Hs01_00048536 predicted 1035
8 SASI_Hs01_00048537 predicted 1629
9 SASI_Hs01_00048538 predicted 1227
10 SASI_Hs01_00048539 predicted 1696
11 SASI_Hs01_00048532 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237909 predicted 753
2 SASI_Rn02_00237910 predicted 1102
3 SASI_Rn02_00237911 predicted 1241
4 SASI_Rn02_00237912 predicted 804
5 SASI_Rn02_00237913 predicted 1022
6 SASI_Rn02_00237914 predicted 751
7 SASI_Rn02_00237915 predicted 391
8 SASI_Rn02_00237916 predicted 568
9 SASI_Rn02_00237917 predicted 435
10 SASI_Rn02_00237918 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132940 predicted 1076
2 SASI_Mm01_00132941 predicted 1149
3 SASI_Mm01_00132943 predicted 878
4 SASI_Mm01_00132944 predicted 430
5 SASI_Mm01_00132945 predicted 480
6 SASI_Mm01_00132946 predicted 817
7 SASI_Mm01_00132947 predicted 516
8 SASI_Mm02_00346695 predicted 1400
9 SASI_Mm01_00132948 predicted 634
10 SASI_Mm01_00132949 predicted 377
11 SASI_Mm01_00132942 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175937
CPEB2 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-953s21c1
Sequence:CCGGACTGCCAGCTTCCGAAGATTTCTCGAGAAATCTTCGGAAGCTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175937.2-1855s21c1
Sequence:CCGGCCTACATCTCAGGCTTACTAACTCGAGTTAGTAAGCCTGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-738s21c1
Sequence:CCGGCACATCCAGGAACCGACAATCCTCGAGGATTGTCGGTTCCTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-427s21c1
Sequence:CCGGTGTTATAGCACCACCGAAATTCTCGAGAATTTCGGTGGTGCTATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-1663s21c1
Sequence:CCGGCTTCCGCTGGAACTAAGTATACTCGAGTATACTTAGTTCCAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-377s1c1
Sequence:CCGGCCAGGGACTATGAATCAGATACTCGAGTATCTGATTCATAGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-1164s1c1
Sequence:CCGGGTCCTTGGAATTTAAGTGATACTCGAGTATCACTTAAATTCCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-1163s1c1
Sequence:CCGGCGTCCTTGGAATTTAAGTGATCTCGAGATCACTTAAATTCCAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-573s1c1
Sequence:CCGGGCTCAGATTCACTCCAAGATACTCGAGTATCTTGGAGTGAATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175937
CPEB2 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-953s21c1
Sequence:CCGGACTGCCAGCTTCCGAAGATTTCTCGAGAAATCTTCGGAAGCTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175937.2-1855s21c1
Sequence:CCGGCCTACATCTCAGGCTTACTAACTCGAGTTAGTAAGCCTGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-738s21c1
Sequence:CCGGCACATCCAGGAACCGACAATCCTCGAGGATTGTCGGTTCCTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-427s21c1
Sequence:CCGGTGTTATAGCACCACCGAAATTCTCGAGAATTTCGGTGGTGCTATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-1663s21c1
Sequence:CCGGCTTCCGCTGGAACTAAGTATACTCGAGTATACTTAGTTCCAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-377s1c1
Sequence:CCGGCCAGGGACTATGAATCAGATACTCGAGTATCTGATTCATAGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-1164s1c1
Sequence:CCGGGTCCTTGGAATTTAAGTGATACTCGAGTATCACTTAAATTCCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-1163s1c1
Sequence:CCGGCGTCCTTGGAATTTAAGTGATCTCGAGATCACTTAAATTCCAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-573s1c1
Sequence:CCGGGCTCAGATTCACTCCAAGATACTCGAGTATCTTGGAGTGAATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175937
CPEB2 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-953s21c1
Sequence:CCGGACTGCCAGCTTCCGAAGATTTCTCGAGAAATCTTCGGAAGCTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175937.2-1855s21c1
Sequence:CCGGCCTACATCTCAGGCTTACTAACTCGAGTTAGTAAGCCTGAGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-738s21c1
Sequence:CCGGCACATCCAGGAACCGACAATCCTCGAGGATTGTCGGTTCCTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-427s21c1
Sequence:CCGGTGTTATAGCACCACCGAAATTCTCGAGAATTTCGGTGGTGCTATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175937.2-1663s21c1
Sequence:CCGGCTTCCGCTGGAACTAAGTATACTCGAGTATACTTAGTTCCAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-377s1c1
Sequence:CCGGCCAGGGACTATGAATCAGATACTCGAGTATCTGATTCATAGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-1164s1c1
Sequence:CCGGGTCCTTGGAATTTAAGTGATACTCGAGTATCACTTAAATTCCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-1163s1c1
Sequence:CCGGCGTCCTTGGAATTTAAGTGATCTCGAGATCACTTAAATTCCAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175937.2-573s1c1
Sequence:CCGGGCTCAGATTCACTCCAAGATACTCGAGTATCTTGGAGTGAATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182485
VALIDATED
CPEB2 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-1422s21c1
Sequence:CCGGAGGTGTTCCTAGGCCATTAAGCTCGAGCTTAATGGCCTAGGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-607s21c1
Sequence:CCGGGTCATAGCACCACCGAAATTTCTCGAGAAATTTCGGTGGTGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-408s21c1
Sequence:CCGGGCAGCAGAGGAACTCCTATAACTCGAGTTATAGGAGTTCCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182485.1-3070s21c1
Sequence:CCGGACCCATAAGAAACCCATATTTCTCGAGAAATATGGGTTTCTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-1601s21c1
Sequence:CCGGAGCTTCAGCATGGTGATATTGCTCGAGCAATATCACCATGCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_182485.1-676s1c1
Sequence:CCGGGTGTTCAGAACAGACAACAATCTCGAGATTGTTGTCTGTTCTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_182485.1-1789s1c1
Sequence:CCGGGAGTTCCATAAGCCATTGGTACTCGAGTACCAATGGCTTATGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182485.1-1255s1c1
Sequence:CCGGGCACTCATTGATGCTTGTATTCTCGAGAATACAAGCATCAATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182485.1-3401s1c1
Sequence:CCGGGCATGGAAACATGCAGTAGTTCTCGAGAACTACTGCATGTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182485.1-1984s1c1
Sequence:CCGGGCATCTTTATCAGCAGCCAAACTCGAGTTTGGCTGCTGATAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182485
VALIDATED
CPEB2 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-1422s21c1
Sequence:CCGGAGGTGTTCCTAGGCCATTAAGCTCGAGCTTAATGGCCTAGGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-607s21c1
Sequence:CCGGGTCATAGCACCACCGAAATTTCTCGAGAAATTTCGGTGGTGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-408s21c1
Sequence:CCGGGCAGCAGAGGAACTCCTATAACTCGAGTTATAGGAGTTCCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182485.1-3070s21c1
Sequence:CCGGACCCATAAGAAACCCATATTTCTCGAGAAATATGGGTTTCTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-1601s21c1
Sequence:CCGGAGCTTCAGCATGGTGATATTGCTCGAGCAATATCACCATGCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_182485.1-676s1c1
Sequence:CCGGGTGTTCAGAACAGACAACAATCTCGAGATTGTTGTCTGTTCTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_182485.1-1789s1c1
Sequence:CCGGGAGTTCCATAAGCCATTGGTACTCGAGTACCAATGGCTTATGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182485.1-1255s1c1
Sequence:CCGGGCACTCATTGATGCTTGTATTCTCGAGAATACAAGCATCAATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182485.1-3401s1c1
Sequence:CCGGGCATGGAAACATGCAGTAGTTCTCGAGAACTACTGCATGTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182485.1-1984s1c1
Sequence:CCGGGCATCTTTATCAGCAGCCAAACTCGAGTTTGGCTGCTGATAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182485
VALIDATED
CPEB2 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-1422s21c1
Sequence:CCGGAGGTGTTCCTAGGCCATTAAGCTCGAGCTTAATGGCCTAGGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-607s21c1
Sequence:CCGGGTCATAGCACCACCGAAATTTCTCGAGAAATTTCGGTGGTGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-408s21c1
Sequence:CCGGGCAGCAGAGGAACTCCTATAACTCGAGTTATAGGAGTTCCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182485.1-3070s21c1
Sequence:CCGGACCCATAAGAAACCCATATTTCTCGAGAAATATGGGTTTCTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182485.1-1601s21c1
Sequence:CCGGAGCTTCAGCATGGTGATATTGCTCGAGCAATATCACCATGCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_182485.1-676s1c1
Sequence:CCGGGTGTTCAGAACAGACAACAATCTCGAGATTGTTGTCTGTTCTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_182485.1-1789s1c1
Sequence:CCGGGAGTTCCATAAGCCATTGGTACTCGAGTACCAATGGCTTATGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182485.1-1255s1c1
Sequence:CCGGGCACTCATTGATGCTTGTATTCTCGAGAATACAAGCATCAATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182485.1-3401s1c1
Sequence:CCGGGCATGGAAACATGCAGTAGTTCTCGAGAACTACTGCATGTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182485.1-1984s1c1
Sequence:CCGGGCATCTTTATCAGCAGCCAAACTCGAGTTTGGCTGCTGATAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks