EMAIL THIS PAGE TO A FRIEND

CPEB3

cytoplasmic polyadenylation element binding protein 3

247 Gene Product Result for
UniProtKB ID: Q8NE35, Q5T389, Q9NQJ7, Q9Y2E9
Gene ID:
Mouse(208922) cytoplasmic polyadenylation element binding protein 3
Rat(309510) cytoplasmic polyadenylation element binding protein 3
Zebrafish(100005268) cytoplasmic polyadenylation element binding protein 3
chicken(423816) cytoplasmic polyadenylation element binding protein 3
cow(537016) cytoplasmic polyadenylation element binding protein 3
Horse(100061932) cytoplasmic polyadenylation element binding protein 3
domestic cat(101084993) cytoplasmic polyadenylation element binding protein 3
dog(486801) cytoplasmic polyadenylation element binding protein 3
domestic guinea pig(100723498) cytoplasmic polyadenylation element binding protein 3
naked mole-rat(101726453) cytoplasmic polyadenylation element binding protein 3
sheep(101102192) cytoplasmic polyadenylation element binding protein 3
Domestic Rabbit(100341373) cytoplasmic polyadenylation element binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063331 MISSION® esiRNA esiRNA human CPEB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014912 Rosetta Predictions human pricing
XM_001080170 Rosetta Predictions rat pricing
XM_220043 Rosetta Predictions rat pricing
NM_198300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050632 predicted 1141
2 SASI_Hs01_00050633 predicted 1291
3 SASI_Hs02_00346553 predicted 1222
4 SASI_Hs01_00050634 predicted 1869
5 SASI_Hs01_00050635 predicted 2031
6 SASI_Hs01_00050636 predicted 1147
7 SASI_Hs01_00050637 predicted 2050
8 SASI_Hs01_00050638 predicted 1244
9 SASI_Hs01_00050639 predicted 1555
10 SASI_Hs01_00050640 predicted 1855
11 SASI_Hs01_00050641 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366924 predicted 1052
2 SASI_Rn02_00366925 predicted 1163
3 SASI_Rn02_00366926 predicted 1201
4 SASI_Rn02_00366927 predicted 1278
5 SASI_Rn02_00366928 predicted 1819
6 SASI_Rn02_00366929 predicted 1061
7 SASI_Rn02_00366930 predicted 1388
8 SASI_Rn02_00366931 predicted 1301
9 SASI_Rn02_00366932 predicted 1294
10 SASI_Rn02_00366933 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378965 predicted 1908
2 SASI_Rn02_00378966 predicted 1635
3 SASI_Rn02_00378967 predicted 2009
4 SASI_Rn02_00378968 predicted 1810
5 SASI_Rn02_00378969 predicted 1821
6 SASI_Rn02_00378970 predicted 1563
7 SASI_Rn02_00378971 predicted 1838
8 SASI_Rn02_00378972 predicted 1990
9 SASI_Rn02_00378973 predicted 1962
10 SASI_Rn02_00378974 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032364 predicted 1192
2 SASI_Mm01_00032365 predicted 1114
3 SASI_Mm01_00032366 predicted 1156
4 SASI_Mm01_00032367 predicted 1813
5 SASI_Mm01_00032369 predicted 1564
6 SASI_Mm01_00032370 predicted 1295
7 SASI_Mm01_00032371 predicted 1266
8 SASI_Mm02_00350931 predicted 1286
9 SASI_Mm01_00032372 predicted 1377
10 SASI_Mm02_00350932 predicted 1393
11 SASI_Mm01_00032363 predicted 1048
12 SASI_Mm01_00032368 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014912
CPEB3 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-1308s1c1
Sequence:CCGGGCTGATATAATGTGGAGGAATCTCGAGATTCCTCCACATTATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-1592s1c1
Sequence:CCGGCAAAGCTGAAAGCAAGTCTTACTCGAGTAAGACTTGCTTTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-2025s1c1
Sequence:CCGGGACATTGACAAACGGGTTGAACTCGAGTTCAACCCGTTTGTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014912.3-3338s21c1
Sequence:CCGGCATAACAGAATGACCTATATTCTCGAGAATATAGGTCATTCTGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1901s21c1
Sequence:CCGGCTGCTATGCTGGCATTGATACCTCGAGGTATCAATGCCAGCATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1225s21c1
Sequence:CCGGACTCCTTAATGGATATGATAACTCGAGTTATCATATCCATTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1295s21c1
Sequence:CCGGACCAATGAGTTTCGCTGATATCTCGAGATATCAGCGAAACTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1135s21c1
Sequence:CCGGACGCTTTCCGGACCGATAATGCTCGAGCATTATCGGTCCGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014912
CPEB3 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-1308s1c1
Sequence:CCGGGCTGATATAATGTGGAGGAATCTCGAGATTCCTCCACATTATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-1592s1c1
Sequence:CCGGCAAAGCTGAAAGCAAGTCTTACTCGAGTAAGACTTGCTTTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-2025s1c1
Sequence:CCGGGACATTGACAAACGGGTTGAACTCGAGTTCAACCCGTTTGTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014912.3-3338s21c1
Sequence:CCGGCATAACAGAATGACCTATATTCTCGAGAATATAGGTCATTCTGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1901s21c1
Sequence:CCGGCTGCTATGCTGGCATTGATACCTCGAGGTATCAATGCCAGCATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1225s21c1
Sequence:CCGGACTCCTTAATGGATATGATAACTCGAGTTATCATATCCATTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1295s21c1
Sequence:CCGGACCAATGAGTTTCGCTGATATCTCGAGATATCAGCGAAACTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1135s21c1
Sequence:CCGGACGCTTTCCGGACCGATAATGCTCGAGCATTATCGGTCCGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014912
CPEB3 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-1308s1c1
Sequence:CCGGGCTGATATAATGTGGAGGAATCTCGAGATTCCTCCACATTATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-1592s1c1
Sequence:CCGGCAAAGCTGAAAGCAAGTCTTACTCGAGTAAGACTTGCTTTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014912.2-2025s1c1
Sequence:CCGGGACATTGACAAACGGGTTGAACTCGAGTTCAACCCGTTTGTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014912.3-3338s21c1
Sequence:CCGGCATAACAGAATGACCTATATTCTCGAGAATATAGGTCATTCTGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1901s21c1
Sequence:CCGGCTGCTATGCTGGCATTGATACCTCGAGGTATCAATGCCAGCATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1225s21c1
Sequence:CCGGACTCCTTAATGGATATGATAACTCGAGTTATCATATCCATTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1295s21c1
Sequence:CCGGACCAATGAGTTTCGCTGATATCTCGAGATATCAGCGAAACTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014912.3-1135s21c1
Sequence:CCGGACGCTTTCCGGACCGATAATGCTCGAGCATTATCGGTCCGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198300
VALIDATED
CPEB3 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198300.1-2579s1c1
Sequence:CCGGCGTGTTGTCGTTGCTCTGATTCTCGAGAATCAGAGCAACGACAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198300.1-1966s1c1
Sequence:CCGGCAACTTCAACACAACGACATTCTCGAGAATGTCGTTGTGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198300.1-2410s1c1
Sequence:CCGGGCAGAATCACAGAGTGTGTAACTCGAGTTACACACTCTGTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198300.1-1556s1c1
Sequence:CCGGGCAAATCGTACTTCCCTCCTACTCGAGTAGGAGGGAAGTACGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198300
VALIDATED
CPEB3 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198300.1-2579s1c1
Sequence:CCGGCGTGTTGTCGTTGCTCTGATTCTCGAGAATCAGAGCAACGACAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198300.1-1966s1c1
Sequence:CCGGCAACTTCAACACAACGACATTCTCGAGAATGTCGTTGTGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198300.1-2410s1c1
Sequence:CCGGGCAGAATCACAGAGTGTGTAACTCGAGTTACACACTCTGTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198300.1-1556s1c1
Sequence:CCGGGCAAATCGTACTTCCCTCCTACTCGAGTAGGAGGGAAGTACGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198300
VALIDATED
CPEB3 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198300.1-2579s1c1
Sequence:CCGGCGTGTTGTCGTTGCTCTGATTCTCGAGAATCAGAGCAACGACAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198300.1-1966s1c1
Sequence:CCGGCAACTTCAACACAACGACATTCTCGAGAATGTCGTTGTGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198300.1-2410s1c1
Sequence:CCGGGCAGAATCACAGAGTGTGTAACTCGAGTTACACACTCTGTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198300.1-1556s1c1
Sequence:CCGGGCAAATCGTACTTCCCTCCTACTCGAGTAGGAGGGAAGTACGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks