EMAIL THIS PAGE TO A FRIEND

CPEB4

cytoplasmic polyadenylation element binding protein 4

UniProtKB ID: Q17RY0, B7ZLQ7, Q7Z310, Q8N405, Q9C0J0
Gene ID:
Mouse(67579) cytoplasmic polyadenylation element binding protein 4
Rat(303010) cytoplasmic polyadenylation element binding protein 4
sheep(101110448) cytoplasmic polyadenylation element binding protein 4
Domestic Rabbit(100343198) cytoplasmic polyadenylation element binding protein 4
naked mole-rat(101721995) cytoplasmic polyadenylation element binding protein 4
domestic guinea pig(100719616) cytoplasmic polyadenylation element binding protein 4
Zebrafish(393956) cytoplasmic polyadenylation element binding protein 4
domestic cat(101089920) cytoplasmic polyadenylation element binding protein 4
dog(479287) cytoplasmic polyadenylation element binding protein 4
chicken(416363) cytoplasmic polyadenylation element binding protein 4
cow(538794) cytoplasmic polyadenylation element binding protein 4
Horse(100058918) cytoplasmic polyadenylation element binding protein 4
244 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030627 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030627 Rosetta Predictions human pricing
NM_001106992 Rosetta Predictions rat pricing
NM_026252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074043 predicted 2000
2 SASI_Hs02_00358189 predicted 2181
3 SASI_Hs01_00074044 predicted 3595
4 SASI_Hs01_00074045 predicted 2558
5 SASI_Hs01_00074046 predicted 2416
6 SASI_Hs01_00074047 predicted 3194
7 SASI_Hs01_00074048 predicted 3372
8 SASI_Hs01_00074049 predicted 2219
9 SASI_Hs01_00074050 predicted 3043
10 SASI_Hs01_00074052 predicted 3355
11 SASI_Hs01_00074051 predicted 2511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224416 predicted 1934
2 SASI_Rn02_00224417 predicted 252
3 SASI_Rn02_00224418 predicted 1227
4 SASI_Rn02_00224419 predicted 1794
5 SASI_Rn02_00224420 predicted 1244
6 SASI_Rn02_00224421 predicted 1131
7 SASI_Rn02_00224422 predicted 2042
8 SASI_Rn02_00224423 predicted 2054
9 SASI_Rn02_00224424 predicted 1538
10 SASI_Rn02_00224425 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177784 predicted 1307
2 SASI_Mm01_00177785 predicted 268
3 SASI_Mm01_00177786 predicted 2039
4 SASI_Mm01_00177787 predicted 1087
5 SASI_Mm01_00177788 predicted 1895
6 SASI_Mm01_00177789 predicted 1712
7 SASI_Mm01_00177790 predicted 1635
8 SASI_Mm01_00177791 predicted 1660
9 SASI_Mm01_00177792 predicted 1312
10 SASI_Mm01_00177793 predicted 1973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026252
VALIDATED
CPEB4 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026252.3-662s21c1
Sequence:CCGGCCCTGGCGCTTCAGCTAATAACTCGAGTTATTAGCTGAAGCGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026252.3-1313s21c1
Sequence:CCGGCGATAGTTCTCTGCTTATTAACTCGAGTTAATAAGCAGAGAACTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-108s1c1
Sequence:CCGGGCAAAGCAATACTGGGAATAACTCGAGTTATTCCCAGTATTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-385s1c1
Sequence:CCGGGAAGCTGGAATACTGCCTGAACTCGAGTTCAGGCAGTATTCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-274s1c1
Sequence:CCGGGCTACTCATAACATTCAGGATCTCGAGATCCTGAATGTTATGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-567s1c1
Sequence:CCGGGTCCCTTACTGGTTTCAGTAACTCGAGTTACTGAAACCAGTAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026252.2-1594s1c1
Sequence:CCGGGCAGAGAGCAAATCTTACTTTCTCGAGAAAGTAAGATTTGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026252
VALIDATED
CPEB4 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026252.3-662s21c1
Sequence:CCGGCCCTGGCGCTTCAGCTAATAACTCGAGTTATTAGCTGAAGCGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026252.3-1313s21c1
Sequence:CCGGCGATAGTTCTCTGCTTATTAACTCGAGTTAATAAGCAGAGAACTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-108s1c1
Sequence:CCGGGCAAAGCAATACTGGGAATAACTCGAGTTATTCCCAGTATTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-385s1c1
Sequence:CCGGGAAGCTGGAATACTGCCTGAACTCGAGTTCAGGCAGTATTCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-274s1c1
Sequence:CCGGGCTACTCATAACATTCAGGATCTCGAGATCCTGAATGTTATGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-567s1c1
Sequence:CCGGGTCCCTTACTGGTTTCAGTAACTCGAGTTACTGAAACCAGTAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026252.2-1594s1c1
Sequence:CCGGGCAGAGAGCAAATCTTACTTTCTCGAGAAAGTAAGATTTGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026252
VALIDATED
CPEB4 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026252.3-662s21c1
Sequence:CCGGCCCTGGCGCTTCAGCTAATAACTCGAGTTATTAGCTGAAGCGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026252.3-1313s21c1
Sequence:CCGGCGATAGTTCTCTGCTTATTAACTCGAGTTAATAAGCAGAGAACTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-108s1c1
Sequence:CCGGGCAAAGCAATACTGGGAATAACTCGAGTTATTCCCAGTATTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-385s1c1
Sequence:CCGGGAAGCTGGAATACTGCCTGAACTCGAGTTCAGGCAGTATTCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-274s1c1
Sequence:CCGGGCTACTCATAACATTCAGGATCTCGAGATCCTGAATGTTATGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026252.2-567s1c1
Sequence:CCGGGTCCCTTACTGGTTTCAGTAACTCGAGTTACTGAAACCAGTAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026252.2-1594s1c1
Sequence:CCGGGCAGAGAGCAAATCTTACTTTCTCGAGAAAGTAAGATTTGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030627
VALIDATED
CPEB4 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic polyadenylation element binding protein 4
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030627.2-2603s21c1
Sequence:CCGGTACCATTAAAGGTCGTCTAAACTCGAGTTTAGACGACCTTTAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030627.2-6052s21c1
Sequence:CCGGAGCTATTGGTGTACCTATAATCTCGAGATTATAGGTACACCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_030627.2-2566s21c1
Sequence:CCGGAGAGTTCACTCATTGACATAACTCGAGTTATGTCAATGAGTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030627.2-1990s21c1
Sequence:CCGGTCCCTGCTGCTTCGGCTAATACTCGAGTATTAGCCGAAGCAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-960s1c1
Sequence:CCGGCCAGTGTTGACAGGGTTTGATCTCGAGATCAAACCCTGTCAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030627.1-1358s1c1
Sequence:CCGGGCTGCCTCATTTGGCGAATAACTCGAGTTATTCGCCAAATGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030627.1-2337s1c1
Sequence:CCGGGCGATGATAATGGATCGGCTACTCGAGTAGCCGATCCATTATCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-1783s1c1
Sequence:CCGGCCGATAGCTCTCTGCTTATTACTCGAGTAATAAGCAGAGAGCTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-5921s1c1
Sequence:CCGGCCCTGCGCTTTGGTATAATATCTCGAGATATTATACCAAAGCGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2714s1c1
Sequence:CCGGGCATATTTCATTCCGCTGGAACTCGAGTTCCAGCGGAATGAAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2056s1c1
Sequence:CCGGCTCATAAAGCTGAGAGCAAATCTCGAGATTTGCTCTCAGCTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-4136s1c1
Sequence:CCGGGCGTTATGTGTTGAACAGTATCTCGAGATACTGTTCAACACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030627.1-5347s1c1
Sequence:CCGGCCACAGCTTCTTACTAAGTTTCTCGAGAAACTTAGTAAGAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-6020s1c1
Sequence:CCGGGCTGTTGGAAAGACTTGATAACTCGAGTTATCAAGTCTTTCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-1784s1c1
Sequence:CCGGCGATAGCTCTCTGCTTATTAACTCGAGTTAATAAGCAGAGAGCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2055s1c1
Sequence:CCGGCCTCATAAAGCTGAGAGCAAACTCGAGTTTGCTCTCAGCTTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-744s1c1
Sequence:CCGGGCTACCCATAACATTCAGGATCTCGAGATCCTGAATGTTATGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030627
VALIDATED
CPEB4 MISSION shRNA shRNA Plasmid DNA
cytoplasmic polyadenylation element binding protein 4
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030627.2-2603s21c1
Sequence:CCGGTACCATTAAAGGTCGTCTAAACTCGAGTTTAGACGACCTTTAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030627.2-6052s21c1
Sequence:CCGGAGCTATTGGTGTACCTATAATCTCGAGATTATAGGTACACCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_030627.2-2566s21c1
Sequence:CCGGAGAGTTCACTCATTGACATAACTCGAGTTATGTCAATGAGTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030627.2-1990s21c1
Sequence:CCGGTCCCTGCTGCTTCGGCTAATACTCGAGTATTAGCCGAAGCAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-960s1c1
Sequence:CCGGCCAGTGTTGACAGGGTTTGATCTCGAGATCAAACCCTGTCAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030627.1-1358s1c1
Sequence:CCGGGCTGCCTCATTTGGCGAATAACTCGAGTTATTCGCCAAATGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030627.1-2337s1c1
Sequence:CCGGGCGATGATAATGGATCGGCTACTCGAGTAGCCGATCCATTATCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-1783s1c1
Sequence:CCGGCCGATAGCTCTCTGCTTATTACTCGAGTAATAAGCAGAGAGCTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-5921s1c1
Sequence:CCGGCCCTGCGCTTTGGTATAATATCTCGAGATATTATACCAAAGCGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2714s1c1
Sequence:CCGGGCATATTTCATTCCGCTGGAACTCGAGTTCCAGCGGAATGAAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2056s1c1
Sequence:CCGGCTCATAAAGCTGAGAGCAAATCTCGAGATTTGCTCTCAGCTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-4136s1c1
Sequence:CCGGGCGTTATGTGTTGAACAGTATCTCGAGATACTGTTCAACACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030627.1-5347s1c1
Sequence:CCGGCCACAGCTTCTTACTAAGTTTCTCGAGAAACTTAGTAAGAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-6020s1c1
Sequence:CCGGGCTGTTGGAAAGACTTGATAACTCGAGTTATCAAGTCTTTCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-1784s1c1
Sequence:CCGGCGATAGCTCTCTGCTTATTAACTCGAGTTAATAAGCAGAGAGCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2055s1c1
Sequence:CCGGCCTCATAAAGCTGAGAGCAAACTCGAGTTTGCTCTCAGCTTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-744s1c1
Sequence:CCGGGCTACCCATAACATTCAGGATCTCGAGATCCTGAATGTTATGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030627
VALIDATED
CPEB4 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic polyadenylation element binding protein 4
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030627.2-2603s21c1
Sequence:CCGGTACCATTAAAGGTCGTCTAAACTCGAGTTTAGACGACCTTTAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030627.2-6052s21c1
Sequence:CCGGAGCTATTGGTGTACCTATAATCTCGAGATTATAGGTACACCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_030627.2-2566s21c1
Sequence:CCGGAGAGTTCACTCATTGACATAACTCGAGTTATGTCAATGAGTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030627.2-1990s21c1
Sequence:CCGGTCCCTGCTGCTTCGGCTAATACTCGAGTATTAGCCGAAGCAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-960s1c1
Sequence:CCGGCCAGTGTTGACAGGGTTTGATCTCGAGATCAAACCCTGTCAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030627.1-1358s1c1
Sequence:CCGGGCTGCCTCATTTGGCGAATAACTCGAGTTATTCGCCAAATGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030627.1-2337s1c1
Sequence:CCGGGCGATGATAATGGATCGGCTACTCGAGTAGCCGATCCATTATCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-1783s1c1
Sequence:CCGGCCGATAGCTCTCTGCTTATTACTCGAGTAATAAGCAGAGAGCTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-5921s1c1
Sequence:CCGGCCCTGCGCTTTGGTATAATATCTCGAGATATTATACCAAAGCGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2714s1c1
Sequence:CCGGGCATATTTCATTCCGCTGGAACTCGAGTTCCAGCGGAATGAAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2056s1c1
Sequence:CCGGCTCATAAAGCTGAGAGCAAATCTCGAGATTTGCTCTCAGCTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-4136s1c1
Sequence:CCGGGCGTTATGTGTTGAACAGTATCTCGAGATACTGTTCAACACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030627.1-5347s1c1
Sequence:CCGGCCACAGCTTCTTACTAAGTTTCTCGAGAAACTTAGTAAGAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030627.1-6020s1c1
Sequence:CCGGGCTGTTGGAAAGACTTGATAACTCGAGTTATCAAGTCTTTCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-1784s1c1
Sequence:CCGGCGATAGCTCTCTGCTTATTAACTCGAGTTAATAAGCAGAGAGCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-2055s1c1
Sequence:CCGGCCTCATAAAGCTGAGAGCAAACTCGAGTTTGCTCTCAGCTTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030627.1-744s1c1
Sequence:CCGGGCTACCCATAACATTCAGGATCTCGAGATCCTGAATGTTATGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks