EMAIL THIS PAGE TO A FRIEND

CPED1

cadherin-like and PC-esterase domain containing 1

176 Gene Product Result for
Synonyms: C7orf58
Gene ID:
Mouse(214642) cadherin-like and PC-esterase domain containing 1
Rat(500046) cadherin-like and PC-esterase domain containing 1
Zebrafish(565332) cadherin-like and PC-esterase domain containing 1
dog(475300) cadherin-like and PC-esterase domain containing 1
cow(617867) cadherin-like and PC-esterase domain containing 1
chicken(417761) cadherin-like and PC-esterase domain containing 1
domestic guinea pig(100721547) cadherin-like and PC-esterase domain containing 1
naked mole-rat(101710855) cadherin-like and PC-esterase domain containing 1
sheep(101102975) cadherin-like and PC-esterase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105533 Rosetta Predictions human pricing
NM_024913 Rosetta Predictions human pricing
XM_001059531 Rosetta Predictions rat pricing
XM_001061323 Rosetta Predictions rat pricing
NM_001081351 Rosetta Predictions mouse pricing
XM_485730 Rosetta Predictions mouse pricing
XM_898270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324241 predicted 891
2 SASI_Hs02_00324242 predicted 458
3 SASI_Hs02_00324243 predicted 1106
4 SASI_Hs02_00324244 predicted 1178
5 SASI_Hs02_00324245 predicted 2280
6 SASI_Hs02_00324246 predicted 663
7 SASI_Hs02_00324247 predicted 1554
8 SASI_Hs02_00324248 predicted 1583
9 SASI_Hs02_00324249 predicted 1010
10 SASI_Hs02_00324250 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357520 predicted 1109
2 SASI_Hs01_00017044 predicted 681
3 SASI_Hs02_00357521 predicted 1322
4 SASI_Hs01_00017047 predicted 1388
5 SASI_Hs02_00357522 predicted 2497
6 SASI_Hs02_00357523 predicted 875
7 SASI_Hs01_00017050 predicted 1763
8 SASI_Hs01_00017052 predicted 1800
9 SASI_Hs02_00357524 predicted 1227
10 SASI_Hs02_00357525 predicted 1783
11 SASI_Hs01_00017045 predicted 2661
12 SASI_Hs01_00017046 predicted 2576
13 SASI_Hs01_00017048 predicted 3267
14 SASI_Hs01_00017049 predicted 3328
15 SASI_Hs01_00017051 predicted 3192
16 SASI_Hs01_00017053 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293529 predicted 1412
2 SASI_Rn02_00293530 predicted 3482
3 SASI_Rn02_00293531 predicted 4036
4 SASI_Rn02_00293532 predicted 944
5 SASI_Rn02_00293533 predicted 2248
6 SASI_Rn02_00293534 predicted 3026
7 SASI_Rn02_00293535 predicted 3059
8 SASI_Rn02_00293536 predicted 1627
9 SASI_Rn02_00293537 predicted 3998
10 SASI_Rn02_00293538 predicted 3448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299626 predicted 1414
2 SASI_Rn02_00299627 predicted 3484
3 SASI_Rn02_00299628 predicted 4042
4 SASI_Rn02_00299629 predicted 952
5 SASI_Rn02_00299630 predicted 2250
6 SASI_Rn02_00299631 predicted 3031
7 SASI_Rn02_00299632 predicted 3059
8 SASI_Rn02_00299633 predicted 1631
9 SASI_Rn02_00299634 predicted 4006
10 SASI_Rn02_00299635 predicted 3454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297561 predicted 3749
2 SASI_Mm02_00297562 predicted 3480
3 SASI_Mm02_00297563 predicted 2240
4 SASI_Mm02_00297564 predicted 1917
5 SASI_Mm02_00297565 predicted 3051
6 SASI_Mm02_00297566 predicted 2459
7 SASI_Mm02_00297567 predicted 1943
8 SASI_Mm02_00297568 predicted 3392
9 SASI_Mm02_00297569 predicted 3692
10 SASI_Mm02_00297570 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204700 predicted 952
2 SASI_Mm01_00204701 predicted 1230
3 SASI_Mm01_00204702 predicted 1094
4 SASI_Mm01_00204703 predicted 1407
5 SASI_Mm01_00204704 predicted 1001
6 SASI_Mm01_00204705 predicted 1265
7 SASI_Mm01_00204706 predicted 1171
8 SASI_Mm01_00204707 predicted 1146
9 SASI_Mm01_00204708 predicted 1059
10 SASI_Mm01_00204709 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247927 predicted 3492
2 SASI_Mm01_00247928 predicted 1702
3 SASI_Mm01_00247929 predicted 3489
4 SASI_Mm01_00247930 predicted 2246
5 SASI_Mm01_00247931 predicted 1920
6 SASI_Mm01_00247932 predicted 3056
7 SASI_Mm01_00247933 predicted 2459
8 SASI_Mm01_00247934 predicted 1947
9 SASI_Mm01_00247935 predicted 2011
10 SASI_Mm01_00247936 predicted 3692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024913
CPED1 MISSION shRNA Bacterial Glycerol Stock
cadherin-like and PC-esterase domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-2594s1c1
Sequence:CCGGGCCTTAGTTGTTCGGACAACACTCGAGTGTTGTCCGAACAACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-867s1c1
Sequence:CCGGCCTGTCTTCTAAGAAAGCAGACTCGAGTCTGCTTTCTTAGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024913.3-3894s1c1
Sequence:CCGGCCAATGACATTCCACTGGCAACTCGAGTTGCCAGTGGAATGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024913.3-3692s1c1
Sequence:CCGGCCAGTCCATTTCACAGTGAAACTCGAGTTTCACTGTGAAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024913.3-3621s1c1
Sequence:CCGGCCAGTACACACACAGTTAAATCTCGAGATTTAACTGTGTGTGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-3185s1c1
Sequence:CCGGGCTATGAAGTAGTTGACACATCTCGAGATGTGTCAACTACTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024913.3-658s1c1
Sequence:CCGGGAATCAATGGAGACACACTTTCTCGAGAAAGTGTGTCTCCATTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-640s1c1
Sequence:CCGGGAAACCAGAAAGGTCAAAGAACTCGAGTTCTTTGACCTTTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-2787s21c1
Sequence:CCGGAGGGATCATGTACTATCTTATCTCGAGATAAGATAGTACATGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-1098s21c1
Sequence:CCGGGGATCAGGGAATGCAATTAAACTCGAGTTTAATTGCATTCCCTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-1233s21c1
Sequence:CCGGCTTTCGAGCCGAAGATCTATCCTCGAGGATAGATCTTCGGCTCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024913
CPED1 MISSION shRNA shRNA Plasmid DNA
cadherin-like and PC-esterase domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-2594s1c1
Sequence:CCGGGCCTTAGTTGTTCGGACAACACTCGAGTGTTGTCCGAACAACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-867s1c1
Sequence:CCGGCCTGTCTTCTAAGAAAGCAGACTCGAGTCTGCTTTCTTAGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024913.3-3894s1c1
Sequence:CCGGCCAATGACATTCCACTGGCAACTCGAGTTGCCAGTGGAATGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024913.3-3692s1c1
Sequence:CCGGCCAGTCCATTTCACAGTGAAACTCGAGTTTCACTGTGAAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024913.3-3621s1c1
Sequence:CCGGCCAGTACACACACAGTTAAATCTCGAGATTTAACTGTGTGTGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-3185s1c1
Sequence:CCGGGCTATGAAGTAGTTGACACATCTCGAGATGTGTCAACTACTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024913.3-658s1c1
Sequence:CCGGGAATCAATGGAGACACACTTTCTCGAGAAAGTGTGTCTCCATTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-640s1c1
Sequence:CCGGGAAACCAGAAAGGTCAAAGAACTCGAGTTCTTTGACCTTTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-2787s21c1
Sequence:CCGGAGGGATCATGTACTATCTTATCTCGAGATAAGATAGTACATGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-1098s21c1
Sequence:CCGGGGATCAGGGAATGCAATTAAACTCGAGTTTAATTGCATTCCCTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-1233s21c1
Sequence:CCGGCTTTCGAGCCGAAGATCTATCCTCGAGGATAGATCTTCGGCTCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024913
CPED1 MISSION shRNA Lentiviral Transduction Particles
cadherin-like and PC-esterase domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-2594s1c1
Sequence:CCGGGCCTTAGTTGTTCGGACAACACTCGAGTGTTGTCCGAACAACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-867s1c1
Sequence:CCGGCCTGTCTTCTAAGAAAGCAGACTCGAGTCTGCTTTCTTAGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024913.3-3894s1c1
Sequence:CCGGCCAATGACATTCCACTGGCAACTCGAGTTGCCAGTGGAATGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024913.3-3692s1c1
Sequence:CCGGCCAGTCCATTTCACAGTGAAACTCGAGTTTCACTGTGAAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024913.3-3621s1c1
Sequence:CCGGCCAGTACACACACAGTTAAATCTCGAGATTTAACTGTGTGTGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-3185s1c1
Sequence:CCGGGCTATGAAGTAGTTGACACATCTCGAGATGTGTCAACTACTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024913.3-658s1c1
Sequence:CCGGGAATCAATGGAGACACACTTTCTCGAGAAAGTGTGTCTCCATTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024913.3-640s1c1
Sequence:CCGGGAAACCAGAAAGGTCAAAGAACTCGAGTTCTTTGACCTTTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-2787s21c1
Sequence:CCGGAGGGATCATGTACTATCTTATCTCGAGATAAGATAGTACATGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-1098s21c1
Sequence:CCGGGGATCAGGGAATGCAATTAAACTCGAGTTTAATTGCATTCCCTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024913.4-1233s21c1
Sequence:CCGGCTTTCGAGCCGAAGATCTATCCTCGAGGATAGATCTTCGGCTCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081351
CPED1 MISSION shRNA Bacterial Glycerol Stock
cadherin-like and PC-esterase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-1427s21c1
Sequence:CCGGAGCCTACATCAAAGGGTAAATCTCGAGATTTACCCTTTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081351.1-4279s21c1
Sequence:CCGGGTACTGGACTGCAACGATAAACTCGAGTTTATCGTTGCAGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-3333s21c1
Sequence:CCGGCGATCAGTTACTCCTACTATCCTCGAGGATAGTAGGAGTAACTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-2245s21c1
Sequence:CCGGCGAGGAAATTCACTCAATTAGCTCGAGCTAATTGAGTGAATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-3895s21c1
Sequence:CCGGTCATGTCAGAGGCCCGATAAACTCGAGTTTATCGGGCCTCTGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081351
CPED1 MISSION shRNA shRNA Plasmid DNA
cadherin-like and PC-esterase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-1427s21c1
Sequence:CCGGAGCCTACATCAAAGGGTAAATCTCGAGATTTACCCTTTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081351.1-4279s21c1
Sequence:CCGGGTACTGGACTGCAACGATAAACTCGAGTTTATCGTTGCAGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-3333s21c1
Sequence:CCGGCGATCAGTTACTCCTACTATCCTCGAGGATAGTAGGAGTAACTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-2245s21c1
Sequence:CCGGCGAGGAAATTCACTCAATTAGCTCGAGCTAATTGAGTGAATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-3895s21c1
Sequence:CCGGTCATGTCAGAGGCCCGATAAACTCGAGTTTATCGGGCCTCTGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081351
CPED1 MISSION shRNA Lentiviral Transduction Particles
cadherin-like and PC-esterase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-1427s21c1
Sequence:CCGGAGCCTACATCAAAGGGTAAATCTCGAGATTTACCCTTTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081351.1-4279s21c1
Sequence:CCGGGTACTGGACTGCAACGATAAACTCGAGTTTATCGTTGCAGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-3333s21c1
Sequence:CCGGCGATCAGTTACTCCTACTATCCTCGAGGATAGTAGGAGTAACTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-2245s21c1
Sequence:CCGGCGAGGAAATTCACTCAATTAGCTCGAGCTAATTGAGTGAATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081351.1-3895s21c1
Sequence:CCGGTCATGTCAGAGGCCCGATAAACTCGAGTTTATCGGGCCTCTGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks