EMAIL THIS PAGE TO A FRIEND

CPLX1

complexin 1

52 Gene Product Result for
Synonyms: CPX-I CPX1
UniProtKB ID: O14810, A6NI80, B2R4R5, D3DVN3
Gene ID:
Human(10815) Summary: Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. [provided by RefSeq, Jul 2008]
Mouse(12889) complexin 1
Rat(64832) complexin 1
sheep(101111194) complexin 1
dog(479134) complexin 1
cow(768228) complexin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048781 MISSION® esiRNA esiRNA targeting mouse Cplx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006651 Rosetta Predictions human pricing
NM_022864 Rosetta Predictions rat pricing
NM_007756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234936 predicted 383
2 SASI_Hs01_00234937 predicted 1057
3 SASI_Hs01_00234939 predicted 1596
4 SASI_Hs01_00234940 predicted 1210
5 SASI_Hs01_00234941 predicted 2096
6 SASI_Hs01_00234942 predicted 1212
7 SASI_Hs02_00342021 predicted 1729
8 SASI_Hs01_00234943 predicted 1735
9 SASI_Hs01_00234944 predicted 1725
10 SASI_Hs01_00234945 predicted 1755
11 SASI_Hs01_00234938 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087702 predicted 267
2 SASI_Rn01_00087703 predicted 587
3 SASI_Rn01_00087704 predicted 250
4 SASI_Rn01_00087705 predicted 218
5 SASI_Rn01_00087706 predicted 216
6 SASI_Rn01_00087707 predicted 415
7 SASI_Rn01_00087708 predicted 275
8 SASI_Rn01_00087709 predicted 879
9 SASI_Rn01_00087710 predicted 325
10 SASI_Rn01_00087711 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195967 predicted 295
2 SASI_Mm01_00195968 predicted 286
3 SASI_Mm01_00195969 predicted 633
4 SASI_Mm01_00195971 predicted 873
5 SASI_Mm01_00195972 predicted 875
6 SASI_Mm01_00195973 predicted 301
7 SASI_Mm01_00195974 predicted 253
8 SASI_Mm01_00195975 predicted 459
9 SASI_Mm01_00195976 predicted 293
10 SASI_Mm02_00312376 predicted 303
11 SASI_Mm01_00195970 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006651
CPLX1 MISSION shRNA Bacterial Glycerol Stock
complexin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1741s1c1
Sequence:CCGGCATAGCTTTAGAGAAGCCATACTCGAGTATGGCTTCTCTAAAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1757s1c1
Sequence:CCGGCCATAACGTTAGACTGCAATACTCGAGTATTGCAGTCTAACGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1192s1c1
Sequence:CCGGCCGTGTTCACTTCTAAACTAACTCGAGTTAGTTTAGAAGTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-391s1c1
Sequence:CCGGGAGACAAGTACGGCATCAAGACTCGAGTCTTGATGCCGTACTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-575s1c1
Sequence:CCGGGCAGGACATGCTCAAGAAGTACTCGAGTACTTCTTGAGCATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-395s1c1
Sequence:CCGGCAAGTACGGCATCAAGAAGAACTCGAGTTCTTCTTGATGCCGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179647    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1191s1c1
Sequence:CCGGGCCGTGTTCACTTCTAAACTACTCGAGTAGTTTAGAAGTGAACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006651.3-389s21c1
Sequence:CCGGCCGAGACAAGTACGGCATCAACTCGAGTTGATGCCGTACTTGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006651
CPLX1 MISSION shRNA shRNA Plasmid DNA
complexin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1741s1c1
Sequence:CCGGCATAGCTTTAGAGAAGCCATACTCGAGTATGGCTTCTCTAAAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1757s1c1
Sequence:CCGGCCATAACGTTAGACTGCAATACTCGAGTATTGCAGTCTAACGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1192s1c1
Sequence:CCGGCCGTGTTCACTTCTAAACTAACTCGAGTTAGTTTAGAAGTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-391s1c1
Sequence:CCGGGAGACAAGTACGGCATCAAGACTCGAGTCTTGATGCCGTACTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-575s1c1
Sequence:CCGGGCAGGACATGCTCAAGAAGTACTCGAGTACTTCTTGAGCATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-395s1c1
Sequence:CCGGCAAGTACGGCATCAAGAAGAACTCGAGTTCTTCTTGATGCCGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179647    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1191s1c1
Sequence:CCGGGCCGTGTTCACTTCTAAACTACTCGAGTAGTTTAGAAGTGAACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006651.3-389s21c1
Sequence:CCGGCCGAGACAAGTACGGCATCAACTCGAGTTGATGCCGTACTTGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006651
CPLX1 MISSION shRNA Lentiviral Transduction Particles
complexin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1741s1c1
Sequence:CCGGCATAGCTTTAGAGAAGCCATACTCGAGTATGGCTTCTCTAAAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1757s1c1
Sequence:CCGGCCATAACGTTAGACTGCAATACTCGAGTATTGCAGTCTAACGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1192s1c1
Sequence:CCGGCCGTGTTCACTTCTAAACTAACTCGAGTTAGTTTAGAAGTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-391s1c1
Sequence:CCGGGAGACAAGTACGGCATCAAGACTCGAGTCTTGATGCCGTACTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-575s1c1
Sequence:CCGGGCAGGACATGCTCAAGAAGTACTCGAGTACTTCTTGAGCATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006651.3-395s1c1
Sequence:CCGGCAAGTACGGCATCAAGAAGAACTCGAGTTCTTCTTGATGCCGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179647    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006651.3-1191s1c1
Sequence:CCGGGCCGTGTTCACTTCTAAACTACTCGAGTAGTTTAGAAGTGAACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006651.3-389s21c1
Sequence:CCGGCCGAGACAAGTACGGCATCAACTCGAGTTGATGCCGTACTTGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007756
VALIDATED
CPLX1 MISSION shRNA Bacterial Glycerol Stock
complexin 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007756.2-1549s1c1
Sequence:CCGGGCAGCCATTGTTCTTCATATTCTCGAGAATATGAAGAACAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-307s1c1
Sequence:CCGGCAGGGTATAAGAGACAAGTATCTCGAGATACTTGTCTCTTATACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-303s1c1
Sequence:CCGGGCGGCAGGGTATAAGAGACAACTCGAGTTGTCTCTTATACCCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-202s1c1
Sequence:CCGGGATGCTGCTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007756.2-258s1c1
Sequence:CCGGGCGCAAAGCAAAGTACGCCAACTCGAGTTGGCGTACTTTGCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-493s21c1
Sequence:GTACCGGTGACTCGACCCAAGAAGGCTACTCGAGTAGCCTTCTTGGGTCGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-376s21c1
Sequence:GTACCGGTGGAGGCAGAACGTGAGGTCACTCGAGTGACCTCACGTTCTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-353s21c1
Sequence:CCGGGCGCAAAGCAAAGTACGCCAACTCGAGTTGGCGTACTTTGCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-554s21c1
Sequence:CCGGGAGCATCCTGGACACTGTCATCTCGAGATGACAGTGTCCAGGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-600s21c1
Sequence:CCGGGACATGTTCAAGAAGTAATGACTCGAGTCATTACTTCTTGAACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007756.3-1644s21c1
Sequence:CCGGGCAGCCATTGTTCTTCATATTCTCGAGAATATGAAGAACAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-398s21c1
Sequence:CCGGGCGGCAGGGTATAAGAGACAACTCGAGTTGTCTCTTATACCCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007756
VALIDATED
CPLX1 MISSION shRNA shRNA Plasmid DNA
complexin 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007756.2-1549s1c1
Sequence:CCGGGCAGCCATTGTTCTTCATATTCTCGAGAATATGAAGAACAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-307s1c1
Sequence:CCGGCAGGGTATAAGAGACAAGTATCTCGAGATACTTGTCTCTTATACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-303s1c1
Sequence:CCGGGCGGCAGGGTATAAGAGACAACTCGAGTTGTCTCTTATACCCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-202s1c1
Sequence:CCGGGATGCTGCTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007756.2-258s1c1
Sequence:CCGGGCGCAAAGCAAAGTACGCCAACTCGAGTTGGCGTACTTTGCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-493s21c1
Sequence:GTACCGGTGACTCGACCCAAGAAGGCTACTCGAGTAGCCTTCTTGGGTCGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-376s21c1
Sequence:GTACCGGTGGAGGCAGAACGTGAGGTCACTCGAGTGACCTCACGTTCTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-353s21c1
Sequence:CCGGGCGCAAAGCAAAGTACGCCAACTCGAGTTGGCGTACTTTGCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-554s21c1
Sequence:CCGGGAGCATCCTGGACACTGTCATCTCGAGATGACAGTGTCCAGGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-600s21c1
Sequence:CCGGGACATGTTCAAGAAGTAATGACTCGAGTCATTACTTCTTGAACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007756.3-1644s21c1
Sequence:CCGGGCAGCCATTGTTCTTCATATTCTCGAGAATATGAAGAACAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-398s21c1
Sequence:CCGGGCGGCAGGGTATAAGAGACAACTCGAGTTGTCTCTTATACCCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007756
VALIDATED
CPLX1 MISSION shRNA Lentiviral Transduction Particles
complexin 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007756.2-1549s1c1
Sequence:CCGGGCAGCCATTGTTCTTCATATTCTCGAGAATATGAAGAACAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-307s1c1
Sequence:CCGGCAGGGTATAAGAGACAAGTATCTCGAGATACTTGTCTCTTATACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-303s1c1
Sequence:CCGGGCGGCAGGGTATAAGAGACAACTCGAGTTGTCTCTTATACCCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007756.2-202s1c1
Sequence:CCGGGATGCTGCTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007756.2-258s1c1
Sequence:CCGGGCGCAAAGCAAAGTACGCCAACTCGAGTTGGCGTACTTTGCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-493s21c1
Sequence:GTACCGGTGACTCGACCCAAGAAGGCTACTCGAGTAGCCTTCTTGGGTCGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-376s21c1
Sequence:GTACCGGTGGAGGCAGAACGTGAGGTCACTCGAGTGACCTCACGTTCTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-353s21c1
Sequence:CCGGGCGCAAAGCAAAGTACGCCAACTCGAGTTGGCGTACTTTGCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-554s21c1
Sequence:CCGGGAGCATCCTGGACACTGTCATCTCGAGATGACAGTGTCCAGGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-600s21c1
Sequence:CCGGGACATGTTCAAGAAGTAATGACTCGAGTCATTACTTCTTGAACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007756.3-1644s21c1
Sequence:CCGGGCAGCCATTGTTCTTCATATTCTCGAGAATATGAAGAACAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007756.3-398s21c1
Sequence:CCGGGCGGCAGGGTATAAGAGACAACTCGAGTTGTCTCTTATACCCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks