EMAIL THIS PAGE TO A FRIEND

CPLX2

complexin 2

140 Gene Product Result for
Synonyms: 921-L CPX-2 CPX2 Hfb1
Gene ID:
Human(10814) Summary: Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12890) complexin 2
Rat(116657) complexin 2
Zebrafish(556701) complexin 2
chicken(427286) complexin 2
dog(489107) complexin 2
cow(281711) complexin 2
sheep(101108392) complexin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105820 Anti-CPLX2, (N-terminal) antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008220 Rosetta Predictions human pricing
NM_006650 Rosetta Predictions human pricing
NM_053878 Rosetta Predictions rat pricing
NM_009946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044220 predicted 2628
2 SASI_Hs01_00044221 predicted 2274
3 SASI_Hs01_00044222 predicted 1671
4 SASI_Hs01_00044223 predicted 3451
5 SASI_Hs02_00305377 predicted 1963
6 SASI_Hs02_00305378 predicted 2011
7 SASI_Hs01_00044224 predicted 1842
8 SASI_Hs01_00044225 predicted 2040
9 SASI_Hs01_00044226 predicted 2053
10 SASI_Hs01_00044227 predicted 1716
11 SASI_Hs01_00044228 predicted 2089
12 SASI_Hs01_00044229 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088734 predicted 2680
2 SASI_Hs01_00088735 predicted 2317
3 SASI_Hs01_00088736 predicted 1717
4 SASI_Hs01_00088737 predicted 3499
5 SASI_Hs02_00342019 predicted 2016
6 SASI_Hs02_00342020 predicted 2060
7 SASI_Hs01_00088738 predicted 1894
8 SASI_Hs01_00088739 predicted 2082
9 SASI_Hs01_00088740 predicted 2105
10 SASI_Hs01_00088741 predicted 1767
11 SASI_Hs01_00088742 predicted 2142
12 SASI_Hs01_00088743 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119246 predicted 453
2 SASI_Rn01_00119247 predicted 449
3 SASI_Rn01_00119248 predicted 471
4 SASI_Rn01_00119250 predicted 473
5 SASI_Rn01_00119251 predicted 461
6 SASI_Rn01_00119252 predicted 472
7 SASI_Rn02_00266784 predicted 367
8 SASI_Rn01_00119253 predicted 440
9 SASI_Rn02_00266785 predicted 498
10 SASI_Rn01_00119254 predicted 453
11 SASI_Rn01_00119249 predicted 475
12 SASI_Rn01_00119255 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143634 predicted 2950
2 SASI_Mm01_00143635 predicted 4385
3 SASI_Mm01_00143636 predicted 2914
4 SASI_Mm01_00143637 predicted 2560
5 SASI_Mm01_00143638 predicted 2050
6 SASI_Mm01_00143639 predicted 2511
7 SASI_Mm01_00143640 predicted 2295
8 SASI_Mm02_00317507 predicted 3586
9 SASI_Mm01_00143641 predicted 2201
10 SASI_Mm01_00143642 predicted 2528
11 SASI_Mm01_00143643 predicted 3657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006650
VALIDATED
CPLX2 MISSION shRNA Bacterial Glycerol Stock
complexin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006650.3-693s21c1
Sequence:CCGGTCCTGGACACGGTGCTCAAATCTCGAGATTTGAGCACCGTGTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006650.3-816s21c1
Sequence:CCGGTATTAGGTTAAGTCTCAATTCCTCGAGGAATTGAGACTTAACCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-574s1c1
Sequence:CCGGGAGAAGGAAGCAGAGGAGAAACTCGAGTTTCTCCTCTGCTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-534s1c1
Sequence:CCGGGCAGCAGATCCGAGATAAGTACTCGAGTACTTATCTCGGATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-726s1c1
Sequence:CCGGGCTGCAGGACATGTTCAAGAACTCGAGTTCTTGAACATGTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-729s1c1
Sequence:CCGGGCAGGACATGTTCAAGAAGTACTCGAGTACTTCTTGAACATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-558s1c1
Sequence:CCGGGCTGAAGAAGAAGGAGGAGAACTCGAGTTCTCCTCCTTCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006650
VALIDATED
CPLX2 MISSION shRNA shRNA Plasmid DNA
complexin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006650.3-693s21c1
Sequence:CCGGTCCTGGACACGGTGCTCAAATCTCGAGATTTGAGCACCGTGTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006650.3-816s21c1
Sequence:CCGGTATTAGGTTAAGTCTCAATTCCTCGAGGAATTGAGACTTAACCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-574s1c1
Sequence:CCGGGAGAAGGAAGCAGAGGAGAAACTCGAGTTTCTCCTCTGCTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-534s1c1
Sequence:CCGGGCAGCAGATCCGAGATAAGTACTCGAGTACTTATCTCGGATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-726s1c1
Sequence:CCGGGCTGCAGGACATGTTCAAGAACTCGAGTTCTTGAACATGTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-729s1c1
Sequence:CCGGGCAGGACATGTTCAAGAAGTACTCGAGTACTTCTTGAACATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-558s1c1
Sequence:CCGGGCTGAAGAAGAAGGAGGAGAACTCGAGTTCTCCTCCTTCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006650
VALIDATED
CPLX2 MISSION shRNA Lentiviral Transduction Particles
complexin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006650.3-693s21c1
Sequence:CCGGTCCTGGACACGGTGCTCAAATCTCGAGATTTGAGCACCGTGTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006650.3-816s21c1
Sequence:CCGGTATTAGGTTAAGTCTCAATTCCTCGAGGAATTGAGACTTAACCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-574s1c1
Sequence:CCGGGAGAAGGAAGCAGAGGAGAAACTCGAGTTTCTCCTCTGCTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-534s1c1
Sequence:CCGGGCAGCAGATCCGAGATAAGTACTCGAGTACTTATCTCGGATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-726s1c1
Sequence:CCGGGCTGCAGGACATGTTCAAGAACTCGAGTTCTTGAACATGTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-729s1c1
Sequence:CCGGGCAGGACATGTTCAAGAAGTACTCGAGTACTTCTTGAACATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006650.2-558s1c1
Sequence:CCGGGCTGAAGAAGAAGGAGGAGAACTCGAGTTCTCCTCCTTCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009946
VALIDATED
CPLX2 MISSION shRNA Bacterial Glycerol Stock
complexin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-401s21c1
Sequence:GTACCGGACGCACAGAAGAAGGAGGAGGCTCGAGCCTCCTCCTTCTTCTGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-506s21c1
Sequence:GTACCGGAGCAGATCCGAGACAAGTATGCTCGAGCATACTTGTCTCGGATCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-693s21c1
Sequence:GTACCGGGCCGCTGCAGGACATGTTCAACTCGAGTTGAACATGTCCTGCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-519s21c1
Sequence:GTACCGGCAAGTATGGGCTGAAGAAGAACTCGAGTTCTTCTTCAGCCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-543s21c1
Sequence:GTACCGGAGAGAAAGAGGCAGAGGAGAACTCGAGTTCTCCTCTGCCTCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009946.1-282s1c1
Sequence:CCGGCCGAGACAAGTATGGGCTGAACTCGAGTTCAGCCCATACTTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-273s1c1
Sequence:CCGGGCAGCAGATCCGAGACAAGTACTCGAGTACTTGTCTCGGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-159s1c1
Sequence:CCGGGAAGGACCCAGACGCACAGAACTCGAGTTCTGTGCGTCTGGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-664s1c1
Sequence:CCGGCCAGGGTTTCTAGTCCTGTTTCTCGAGAAACAGGACTAGAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-433s1c1
Sequence:CCGGCTGGACACAGTGCTCAAATATCTCGAGATATTTGAGCACTGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009946
VALIDATED
CPLX2 MISSION shRNA shRNA Plasmid DNA
complexin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-401s21c1
Sequence:GTACCGGACGCACAGAAGAAGGAGGAGGCTCGAGCCTCCTCCTTCTTCTGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-506s21c1
Sequence:GTACCGGAGCAGATCCGAGACAAGTATGCTCGAGCATACTTGTCTCGGATCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-693s21c1
Sequence:GTACCGGGCCGCTGCAGGACATGTTCAACTCGAGTTGAACATGTCCTGCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-519s21c1
Sequence:GTACCGGCAAGTATGGGCTGAAGAAGAACTCGAGTTCTTCTTCAGCCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-543s21c1
Sequence:GTACCGGAGAGAAAGAGGCAGAGGAGAACTCGAGTTCTCCTCTGCCTCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009946.1-282s1c1
Sequence:CCGGCCGAGACAAGTATGGGCTGAACTCGAGTTCAGCCCATACTTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-273s1c1
Sequence:CCGGGCAGCAGATCCGAGACAAGTACTCGAGTACTTGTCTCGGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-159s1c1
Sequence:CCGGGAAGGACCCAGACGCACAGAACTCGAGTTCTGTGCGTCTGGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-664s1c1
Sequence:CCGGCCAGGGTTTCTAGTCCTGTTTCTCGAGAAACAGGACTAGAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-433s1c1
Sequence:CCGGCTGGACACAGTGCTCAAATATCTCGAGATATTTGAGCACTGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009946
VALIDATED
CPLX2 MISSION shRNA Lentiviral Transduction Particles
complexin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-401s21c1
Sequence:GTACCGGACGCACAGAAGAAGGAGGAGGCTCGAGCCTCCTCCTTCTTCTGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-506s21c1
Sequence:GTACCGGAGCAGATCCGAGACAAGTATGCTCGAGCATACTTGTCTCGGATCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-693s21c1
Sequence:GTACCGGGCCGCTGCAGGACATGTTCAACTCGAGTTGAACATGTCCTGCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-519s21c1
Sequence:GTACCGGCAAGTATGGGCTGAAGAAGAACTCGAGTTCTTCTTCAGCCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009946.2-543s21c1
Sequence:GTACCGGAGAGAAAGAGGCAGAGGAGAACTCGAGTTCTCCTCTGCCTCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009946.1-282s1c1
Sequence:CCGGCCGAGACAAGTATGGGCTGAACTCGAGTTCAGCCCATACTTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-273s1c1
Sequence:CCGGGCAGCAGATCCGAGACAAGTACTCGAGTACTTGTCTCGGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-159s1c1
Sequence:CCGGGAAGGACCCAGACGCACAGAACTCGAGTTCTGTGCGTCTGGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-664s1c1
Sequence:CCGGCCAGGGTTTCTAGTCCTGTTTCTCGAGAAACAGGACTAGAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009946.1-433s1c1
Sequence:CCGGCTGGACACAGTGCTCAAATATCTCGAGATATTTGAGCACTGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks