EMAIL THIS PAGE TO A FRIEND

CPLX3

complexin 3

45 Gene Product Result for
Synonyms: CPX-III CPXIII
UniProtKB ID: Q8WVH0, D3DW66, Q8TEM6, Q9H818
Gene ID:
Mouse(235415) complexin 3
Rat(501005) complexin 3
chicken(769798) complexin 3
dog(611573) complexin 3
cow(509248) complexin 3
sheep(101108426) complexin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001030005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001030005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001030005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231201 MISSION® esiRNA esiRNA targeting human CPLX3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030005 Rosetta Predictions human pricing
NM_001109295 Rosetta Predictions rat pricing
NM_146223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229035 predicted 314
2 SASI_Hs01_00229036 predicted 346
3 SASI_Hs01_00229037 predicted 205
4 SASI_Hs01_00229038 predicted 547
5 SASI_Hs01_00229039 predicted 548
6 SASI_Hs01_00229040 predicted 532
7 SASI_Hs01_00229041 predicted 199
8 SASI_Hs01_00229042 predicted 612
9 SASI_Hs01_00229043 predicted 484
10 SASI_Hs01_00229044 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247014 predicted 626
2 SASI_Rn02_00247015 predicted 603
3 SASI_Rn02_00247016 predicted 1309
4 SASI_Rn02_00247017 predicted 829
5 SASI_Rn02_00247018 predicted 897
6 SASI_Rn02_00247019 predicted 379
7 SASI_Rn02_00247020 predicted 913
8 SASI_Rn02_00247021 predicted 1112
9 SASI_Rn02_00247022 predicted 949
10 SASI_Rn02_00247023 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060687 predicted 1041
2 SASI_Mm01_00060688 predicted 492
3 SASI_Mm01_00060689 predicted 1045
4 SASI_Mm01_00060690 predicted 1030
5 SASI_Mm02_00341924 predicted 302
6 SASI_Mm01_00060691 predicted 626
7 SASI_Mm01_00060692 predicted 640
8 SASI_Mm01_00060693 predicted 532
9 SASI_Mm01_00060694 predicted 620
10 SASI_Mm01_00060695 predicted 85
11 SASI_Mm01_00060696 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030005
CPLX3 MISSION shRNA Bacterial Glycerol Stock
complexin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030005.1-1073s1c1
Sequence:CCGGCCACCTTTATTGTTCTTGAAACTCGAGTTTCAAGAACAATAAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-549s1c1
Sequence:CCGGCTGAGAAGTGTCACGTCATGTCTCGAGACATGACGTGACACTTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-313s1c1
Sequence:CCGGGAGCCACTTCCGAGACAAATACTCGAGTATTTGTCTCGGAAGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-238s1c1
Sequence:CCGGGAAGCAACTCGTGGAAGAGAACTCGAGTTCTCTTCCACGAGTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-226s1c1
Sequence:CCGGCGAGGAGTATCAGAAGCAACTCTCGAGAGTTGCTTCTGATACTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030005
CPLX3 MISSION shRNA shRNA Plasmid DNA
complexin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030005.1-1073s1c1
Sequence:CCGGCCACCTTTATTGTTCTTGAAACTCGAGTTTCAAGAACAATAAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-549s1c1
Sequence:CCGGCTGAGAAGTGTCACGTCATGTCTCGAGACATGACGTGACACTTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-313s1c1
Sequence:CCGGGAGCCACTTCCGAGACAAATACTCGAGTATTTGTCTCGGAAGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-238s1c1
Sequence:CCGGGAAGCAACTCGTGGAAGAGAACTCGAGTTCTCTTCCACGAGTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-226s1c1
Sequence:CCGGCGAGGAGTATCAGAAGCAACTCTCGAGAGTTGCTTCTGATACTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030005
CPLX3 MISSION shRNA Lentiviral Transduction Particles
complexin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030005.1-1073s1c1
Sequence:CCGGCCACCTTTATTGTTCTTGAAACTCGAGTTTCAAGAACAATAAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-549s1c1
Sequence:CCGGCTGAGAAGTGTCACGTCATGTCTCGAGACATGACGTGACACTTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-313s1c1
Sequence:CCGGGAGCCACTTCCGAGACAAATACTCGAGTATTTGTCTCGGAAGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-238s1c1
Sequence:CCGGGAAGCAACTCGTGGAAGAGAACTCGAGTTCTCTTCCACGAGTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030005.1-226s1c1
Sequence:CCGGCGAGGAGTATCAGAAGCAACTCTCGAGAGTTGCTTCTGATACTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146223
CPLX3 MISSION shRNA Bacterial Glycerol Stock
complexin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-308s21c1
Sequence:CCGGAGTCACTTCAGAGACAAATACCTCGAGGTATTTGTCTCTGAAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-210s21c1
Sequence:CCGGGAGAAGAGTACGAGGAGTATCCTCGAGGATACTCCTCGTACTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-489s21c1
Sequence:CCGGTCAGCTCACTCAAGGACAAAGCTCGAGCTTTGTCCTTGAGTGAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146223.2-2233s21c1
Sequence:CCGGATGTGTGTTAGTTGGTATTATCTCGAGATAATACCAACTAACACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-541s21c1
Sequence:CCGGAGCTGAGAAGTGCCATATCATCTCGAGATGATATGGCACTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146223
CPLX3 MISSION shRNA shRNA Plasmid DNA
complexin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-308s21c1
Sequence:CCGGAGTCACTTCAGAGACAAATACCTCGAGGTATTTGTCTCTGAAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-210s21c1
Sequence:CCGGGAGAAGAGTACGAGGAGTATCCTCGAGGATACTCCTCGTACTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-489s21c1
Sequence:CCGGTCAGCTCACTCAAGGACAAAGCTCGAGCTTTGTCCTTGAGTGAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146223.2-2233s21c1
Sequence:CCGGATGTGTGTTAGTTGGTATTATCTCGAGATAATACCAACTAACACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-541s21c1
Sequence:CCGGAGCTGAGAAGTGCCATATCATCTCGAGATGATATGGCACTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146223
CPLX3 MISSION shRNA Lentiviral Transduction Particles
complexin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-308s21c1
Sequence:CCGGAGTCACTTCAGAGACAAATACCTCGAGGTATTTGTCTCTGAAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-210s21c1
Sequence:CCGGGAGAAGAGTACGAGGAGTATCCTCGAGGATACTCCTCGTACTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-489s21c1
Sequence:CCGGTCAGCTCACTCAAGGACAAAGCTCGAGCTTTGTCCTTGAGTGAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146223.2-2233s21c1
Sequence:CCGGATGTGTGTTAGTTGGTATTATCTCGAGATAATACCAACTAACACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146223.2-541s21c1
Sequence:CCGGAGCTGAGAAGTGCCATATCATCTCGAGATGATATGGCACTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)