EMAIL THIS PAGE TO A FRIEND

CPLX4

complexin 4

60 Gene Product Result for
Synonyms: CPX-IV CPXIV
UniProtKB ID: Q7Z7G2
Gene ID:
Human(339302) Summary: This gene likely encodes a member of the complexin family. The encoded protein may be involved in synaptic vesicle exocytosis. [provided by RefSeq, Jan 2009]
Mouse(225644) complexin 4
Rat(361342) complexin 4
chicken(769026) complexin 4
dog(612922) complexin 4
cow(616684) complexin 4
sheep(101102111) complexin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181654 Rosetta Predictions human pricing
XM_001065314 Rosetta Predictions rat pricing
XM_341625 Rosetta Predictions rat pricing
NM_145493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164514 predicted 573
2 SASI_Hs01_00164515 predicted 792
3 SASI_Hs01_00164516 predicted 540
4 SASI_Hs01_00164517 predicted 731
5 SASI_Hs01_00164518 predicted 787
6 SASI_Hs01_00164521 predicted 1009
7 SASI_Hs02_00370232 predicted 724
8 SASI_Hs02_00370233 predicted 796
9 SASI_Hs02_00370234 predicted 545
10 SASI_Hs02_00370235 predicted 756
11 SASI_Hs01_00164519 predicted 384
12 SASI_Hs01_00164520 predicted 788
13 SASI_Hs01_00164522 predicted 1172
14 SASI_Hs01_00164523 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313711 predicted 430
2 SASI_Rn02_00313712 predicted 498
3 SASI_Rn02_00313713 predicted 362
4 SASI_Rn02_00313714 predicted 529
5 SASI_Rn02_00313715 predicted 578
6 SASI_Rn02_00313716 predicted 456
7 SASI_Rn02_00313717 predicted 206
8 SASI_Rn02_00313718 predicted 360
9 SASI_Rn02_00313719 predicted 316
10 SASI_Rn02_00313720 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393159 predicted 429
2 SASI_Rn02_00393160 predicted 504
3 SASI_Rn02_00393161 predicted 365
4 SASI_Rn02_00393162 predicted 528
5 SASI_Rn02_00393163 predicted 582
6 SASI_Rn02_00393164 predicted 455
7 SASI_Rn02_00393165 predicted 200
8 SASI_Rn02_00393166 predicted 356
9 SASI_Rn02_00393167 predicted 322
10 SASI_Rn02_00393168 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184771 predicted 835
2 SASI_Mm01_00184772 predicted 378
3 SASI_Mm01_00184773 predicted 813
4 SASI_Mm01_00184774 predicted 809
5 SASI_Mm02_00340938 predicted 1064
6 SASI_Mm01_00184775 predicted 669
7 SASI_Mm01_00184776 predicted 363
8 SASI_Mm01_00184778 predicted 846
9 SASI_Mm01_00184779 predicted 771
10 SASI_Mm01_00184780 predicted 777
11 SASI_Mm01_00184777 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181654
CPLX4 MISSION shRNA Bacterial Glycerol Stock
complexin 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181654.3-926s21c1
Sequence:CCGGAGAACACATATCTGCTTAAAGCTCGAGCTTTAAGCAGATATGTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181654.3-787s21c1
Sequence:CCGGGATCCATTGACAGACAATAATCTCGAGATTATTGTCTGTCAATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-144s1c1
Sequence:CCGGGAGGAGTATGAGGAGTATCAACTCGAGTTGATACTCCTCATACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-177s1c1
Sequence:CCGGGAGGAGAAGATGGAAAGAGATCTCGAGATCTCTTTCCATCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-264s1c1
Sequence:CCGGCTCCCAAAGAGTGAAATGGATCTCGAGATCCATTTCACTCTTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-312s1c1
Sequence:CCGGGATGTGGATTTACCTGAAGATCTCGAGATCTTCAGGTAAATCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-274s1c1
Sequence:CCGGGTGAAATGGATGAGAATCAAACTCGAGTTTGATTCTCATCCATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181654
CPLX4 MISSION shRNA shRNA Plasmid DNA
complexin 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181654.3-926s21c1
Sequence:CCGGAGAACACATATCTGCTTAAAGCTCGAGCTTTAAGCAGATATGTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181654.3-787s21c1
Sequence:CCGGGATCCATTGACAGACAATAATCTCGAGATTATTGTCTGTCAATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-144s1c1
Sequence:CCGGGAGGAGTATGAGGAGTATCAACTCGAGTTGATACTCCTCATACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-177s1c1
Sequence:CCGGGAGGAGAAGATGGAAAGAGATCTCGAGATCTCTTTCCATCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-264s1c1
Sequence:CCGGCTCCCAAAGAGTGAAATGGATCTCGAGATCCATTTCACTCTTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-312s1c1
Sequence:CCGGGATGTGGATTTACCTGAAGATCTCGAGATCTTCAGGTAAATCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-274s1c1
Sequence:CCGGGTGAAATGGATGAGAATCAAACTCGAGTTTGATTCTCATCCATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181654
CPLX4 MISSION shRNA Lentiviral Transduction Particles
complexin 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181654.3-926s21c1
Sequence:CCGGAGAACACATATCTGCTTAAAGCTCGAGCTTTAAGCAGATATGTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181654.3-787s21c1
Sequence:CCGGGATCCATTGACAGACAATAATCTCGAGATTATTGTCTGTCAATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-144s1c1
Sequence:CCGGGAGGAGTATGAGGAGTATCAACTCGAGTTGATACTCCTCATACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-177s1c1
Sequence:CCGGGAGGAGAAGATGGAAAGAGATCTCGAGATCTCTTTCCATCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-264s1c1
Sequence:CCGGCTCCCAAAGAGTGAAATGGATCTCGAGATCCATTTCACTCTTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-312s1c1
Sequence:CCGGGATGTGGATTTACCTGAAGATCTCGAGATCTTCAGGTAAATCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181654.1-274s1c1
Sequence:CCGGGTGAAATGGATGAGAATCAAACTCGAGTTTGATTCTCATCCATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145493
CPLX4 MISSION shRNA Bacterial Glycerol Stock
complexin 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-527s1c1
Sequence:CCGGCATGGACTTGGATACCATTAACTCGAGTTAATGGTATCCAAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-374s1c1
Sequence:CCGGCAGGCTTCCAAAGAGTGAAATCTCGAGATTTCACTCTTTGGAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-528s21c1
Sequence:CCGGATGGACTTGGATACCATTAAACTCGAGTTTAATGGTATCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-254s21c1
Sequence:CCGGTAGAGAGGAATACGAGGAATACTCGAGTATTCCTCGTATTCCTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-480s21c1
Sequence:CCGGGAAGAGGAGAAGGATTCTATCCTCGAGGATAGAATCCTTCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-301s21c1
Sequence:CCGGTGGAGAGAGATGCCGCATTTACTCGAGTAAATGCGGCATCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145493.1-658s21c1
Sequence:CCGGGCATGACCAGCACGCATTATACTCGAGTATAATGCGTGCTGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-488s1c1
Sequence:CCGGGAAGGATTCTATCCTTGGGCACTCGAGTGCCCAAGGATAGAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145493.1-1477s1c1
Sequence:CCGGCCTCTGTGAAAGGATTGAGAACTCGAGTTCTCAATCCTTTCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-423s1c1
Sequence:CCGGGACGATGTGGACTTACCAGAACTCGAGTTCTGGTAAGTCCACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145493
CPLX4 MISSION shRNA shRNA Plasmid DNA
complexin 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-527s1c1
Sequence:CCGGCATGGACTTGGATACCATTAACTCGAGTTAATGGTATCCAAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-374s1c1
Sequence:CCGGCAGGCTTCCAAAGAGTGAAATCTCGAGATTTCACTCTTTGGAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-528s21c1
Sequence:CCGGATGGACTTGGATACCATTAAACTCGAGTTTAATGGTATCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-254s21c1
Sequence:CCGGTAGAGAGGAATACGAGGAATACTCGAGTATTCCTCGTATTCCTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-480s21c1
Sequence:CCGGGAAGAGGAGAAGGATTCTATCCTCGAGGATAGAATCCTTCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-301s21c1
Sequence:CCGGTGGAGAGAGATGCCGCATTTACTCGAGTAAATGCGGCATCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145493.1-658s21c1
Sequence:CCGGGCATGACCAGCACGCATTATACTCGAGTATAATGCGTGCTGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-488s1c1
Sequence:CCGGGAAGGATTCTATCCTTGGGCACTCGAGTGCCCAAGGATAGAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145493.1-1477s1c1
Sequence:CCGGCCTCTGTGAAAGGATTGAGAACTCGAGTTCTCAATCCTTTCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-423s1c1
Sequence:CCGGGACGATGTGGACTTACCAGAACTCGAGTTCTGGTAAGTCCACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145493
CPLX4 MISSION shRNA Lentiviral Transduction Particles
complexin 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-527s1c1
Sequence:CCGGCATGGACTTGGATACCATTAACTCGAGTTAATGGTATCCAAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-374s1c1
Sequence:CCGGCAGGCTTCCAAAGAGTGAAATCTCGAGATTTCACTCTTTGGAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-528s21c1
Sequence:CCGGATGGACTTGGATACCATTAAACTCGAGTTTAATGGTATCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-254s21c1
Sequence:CCGGTAGAGAGGAATACGAGGAATACTCGAGTATTCCTCGTATTCCTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-480s21c1
Sequence:CCGGGAAGAGGAGAAGGATTCTATCCTCGAGGATAGAATCCTTCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145493.1-301s21c1
Sequence:CCGGTGGAGAGAGATGCCGCATTTACTCGAGTAAATGCGGCATCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145493.1-658s21c1
Sequence:CCGGGCATGACCAGCACGCATTATACTCGAGTATAATGCGTGCTGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-488s1c1
Sequence:CCGGGAAGGATTCTATCCTTGGGCACTCGAGTGCCCAAGGATAGAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145493.1-1477s1c1
Sequence:CCGGCCTCTGTGAAAGGATTGAGAACTCGAGTTCTCAATCCTTTCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145493.1-423s1c1
Sequence:CCGGGACGATGTGGACTTACCAGAACTCGAGTTCTGGTAAGTCCACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks