EMAIL THIS PAGE TO A FRIEND

CPM

carboxypeptidase M

UniProtKB ID: P14384, B2R800, Q9H2K9
Gene ID:
Human(1368) Summary: The protein encoded by this gene is a membrane-bound arginine/lysine carboxypeptidase. Its expression is associated with monocyte to macrophage differentiation. This encoded protein contains hydrophobic regions at the amino and carboxy termini and has 6 potential asparagine-linked glycosylation sites. The active site residues of carboxypeptidases A and B are conserved in this protein. Three alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(70574) carboxypeptidase M
Rat(314855) carboxypeptidase M
Zebrafish(550253) carboxypeptidase M
cow(513281) carboxypeptidase M
Horse(100059473) carboxypeptidase M
domestic cat(101097407) carboxypeptidase M
dog(100685525) carboxypeptidase M
chicken(417843) carboxypeptidase M
sheep(101104474) carboxypeptidase M
domestic guinea pig(100732968) carboxypeptidase M
naked mole-rat(101724468) carboxypeptidase M
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B8011 DL-Benzylsuccinic acid ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001874 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005502 Rosetta Predictions human pricing
NM_001874 Rosetta Predictions human pricing
NM_198320 Rosetta Predictions human pricing
NM_001108098 Rosetta Predictions rat pricing
NM_027468 Rosetta Predictions mouse pricing
XM_994613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304969 predicted 584
2 SASI_Hs01_00073130 predicted 1267
3 SASI_Hs01_00073131 predicted 662
4 SASI_Hs01_00073132 predicted 789
5 SASI_Hs01_00073133 predicted 982
6 SASI_Hs01_00073134 predicted 1088
7 SASI_Hs01_00073135 predicted 774
8 SASI_Hs01_00073136 predicted 479
9 SASI_Hs01_00073137 predicted 623
10 SASI_Hs01_00073138 predicted 1415
11 SASI_Hs01_00073139 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332722 predicted 608
2 SASI_Hs01_00232177 predicted 1301
3 SASI_Hs01_00232178 predicted 694
4 SASI_Hs01_00232179 predicted 821
5 SASI_Hs01_00232180 predicted 1007
6 SASI_Hs01_00232181 predicted 1117
7 SASI_Hs01_00232182 predicted 811
8 SASI_Hs01_00232183 predicted 512
9 SASI_Hs01_00232184 predicted 662
10 SASI_Hs01_00232185 predicted 1450
11 SASI_Hs01_00232186 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371874 predicted 603
2 SASI_Hs01_00188361 predicted 1291
3 SASI_Hs01_00188362 predicted 683
4 SASI_Hs01_00188363 predicted 807
5 SASI_Hs01_00188364 predicted 996
6 SASI_Hs01_00188365 predicted 1104
7 SASI_Hs01_00188366 predicted 795
8 SASI_Hs01_00188367 predicted 500
9 SASI_Hs01_00188368 predicted 646
10 SASI_Hs01_00188369 predicted 1434
11 SASI_Hs01_00188370 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235334 predicted 544
2 SASI_Rn02_00235335 predicted 322
3 SASI_Rn02_00235336 predicted 932
4 SASI_Rn02_00235337 predicted 1262
5 SASI_Rn02_00235338 predicted 253
6 SASI_Rn02_00235339 predicted 1259
7 SASI_Rn02_00235340 predicted 969
8 SASI_Rn02_00235341 predicted 1157
9 SASI_Rn02_00235342 predicted 1150
10 SASI_Rn02_00235343 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332258 predicted 567
2 SASI_Mm02_00332259 predicted 816
3 SASI_Mm02_00332260 predicted 1032
4 SASI_Mm02_00332261 predicted 1259
5 SASI_Mm02_00332262 predicted 317
6 SASI_Mm02_00332263 predicted 1154
7 SASI_Mm02_00332264 predicted 543
8 SASI_Mm02_00332265 predicted 1399
9 SASI_Mm02_00332266 predicted 773
10 SASI_Mm02_00332267 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215177 predicted 891
2 SASI_Mm01_00215178 predicted 1141
3 SASI_Mm01_00215179 predicted 1357
4 SASI_Mm01_00215180 predicted 639
5 SASI_Mm01_00215181 predicted 1384
6 SASI_Mm01_00215182 predicted 821
7 SASI_Mm01_00215183 predicted 1470
8 SASI_Mm01_00215184 predicted 867
9 SASI_Mm01_00215185 predicted 1723
10 SASI_Mm01_00215186 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001874
VALIDATED
CPM MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase M
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-548s1c1
Sequence:CCGGCCAGTATGACTTGAATCGAAACTCGAGTTTCGATTCAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-425s1c1
Sequence:CCGGCCCTGAAATCACAAATCTGATCTCGAGATCAGATTTGTGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-1250s1c1
Sequence:CCGGCCAGAACTTCAGTGCTCTTAACTCGAGTTAAGAGCACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-1138s1c1
Sequence:CCGGCCAACAAATATGGAGAGTATTCTCGAGAATACTCTCCATATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001874.2-699s1c1
Sequence:CCGGCCATTTGATAATGGTGTTCAACTCGAGTTGAACACCATTATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-396s21c1
Sequence:CCGGCCCTGAAATCACAAATCTGATCTCGAGATCAGATTTGTGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-1221s21c1
Sequence:CCGGCCAGAACTTCAGTGCTCTTAACTCGAGTTAAGAGCACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-519s21c1
Sequence:CCGGCCAGTATGACTTGAATCGAAACTCGAGTTTCGATTCAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-1109s21c1
Sequence:CCGGCCAACAAATATGGAGAGTATTCTCGAGAATACTCTCCATATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001874
VALIDATED
CPM MISSION shRNA shRNA Plasmid DNA
carboxypeptidase M
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-548s1c1
Sequence:CCGGCCAGTATGACTTGAATCGAAACTCGAGTTTCGATTCAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-425s1c1
Sequence:CCGGCCCTGAAATCACAAATCTGATCTCGAGATCAGATTTGTGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-1250s1c1
Sequence:CCGGCCAGAACTTCAGTGCTCTTAACTCGAGTTAAGAGCACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-1138s1c1
Sequence:CCGGCCAACAAATATGGAGAGTATTCTCGAGAATACTCTCCATATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001874.2-699s1c1
Sequence:CCGGCCATTTGATAATGGTGTTCAACTCGAGTTGAACACCATTATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-396s21c1
Sequence:CCGGCCCTGAAATCACAAATCTGATCTCGAGATCAGATTTGTGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-1221s21c1
Sequence:CCGGCCAGAACTTCAGTGCTCTTAACTCGAGTTAAGAGCACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-519s21c1
Sequence:CCGGCCAGTATGACTTGAATCGAAACTCGAGTTTCGATTCAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-1109s21c1
Sequence:CCGGCCAACAAATATGGAGAGTATTCTCGAGAATACTCTCCATATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001874
VALIDATED
CPM MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase M
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-548s1c1
Sequence:CCGGCCAGTATGACTTGAATCGAAACTCGAGTTTCGATTCAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-425s1c1
Sequence:CCGGCCCTGAAATCACAAATCTGATCTCGAGATCAGATTTGTGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-1250s1c1
Sequence:CCGGCCAGAACTTCAGTGCTCTTAACTCGAGTTAAGAGCACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001874.2-1138s1c1
Sequence:CCGGCCAACAAATATGGAGAGTATTCTCGAGAATACTCTCCATATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001874.2-699s1c1
Sequence:CCGGCCATTTGATAATGGTGTTCAACTCGAGTTGAACACCATTATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-396s21c1
Sequence:CCGGCCCTGAAATCACAAATCTGATCTCGAGATCAGATTTGTGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-1221s21c1
Sequence:CCGGCCAGAACTTCAGTGCTCTTAACTCGAGTTAAGAGCACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-519s21c1
Sequence:CCGGCCAGTATGACTTGAATCGAAACTCGAGTTTCGATTCAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001874.4-1109s21c1
Sequence:CCGGCCAACAAATATGGAGAGTATTCTCGAGAATACTCTCCATATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125830
VALIDATED
CPM MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase M
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125830.3-823s1c1
Sequence:CCGGCCCTTTGATAATGGCGTACAACTCGAGTTGTACGCCATTATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125830.3-1469s1c1
Sequence:CCGGCGCTGTACAAATTCATGCCAACTCGAGTTGGCATGAATTTGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-550s1c1
Sequence:CCGGCCGGAAATCACGCATCTGATTCTCGAGAATCAGATGCGTGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-703s1c1
Sequence:CCGGGCCTTTGAGAATAACAATGTACTCGAGTACATTGTTATTCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-1132s1c1
Sequence:CCGGGCCTCTTTGATCGAATATATACTCGAGTATATATTCGATCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125830
VALIDATED
CPM MISSION shRNA shRNA Plasmid DNA
carboxypeptidase M
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125830.3-823s1c1
Sequence:CCGGCCCTTTGATAATGGCGTACAACTCGAGTTGTACGCCATTATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125830.3-1469s1c1
Sequence:CCGGCGCTGTACAAATTCATGCCAACTCGAGTTGGCATGAATTTGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-550s1c1
Sequence:CCGGCCGGAAATCACGCATCTGATTCTCGAGAATCAGATGCGTGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-703s1c1
Sequence:CCGGGCCTTTGAGAATAACAATGTACTCGAGTACATTGTTATTCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-1132s1c1
Sequence:CCGGGCCTCTTTGATCGAATATATACTCGAGTATATATTCGATCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125830
VALIDATED
CPM MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase M
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125830.3-823s1c1
Sequence:CCGGCCCTTTGATAATGGCGTACAACTCGAGTTGTACGCCATTATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125830.3-1469s1c1
Sequence:CCGGCGCTGTACAAATTCATGCCAACTCGAGTTGGCATGAATTTGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-550s1c1
Sequence:CCGGCCGGAAATCACGCATCTGATTCTCGAGAATCAGATGCGTGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-703s1c1
Sequence:CCGGGCCTTTGAGAATAACAATGTACTCGAGTACATTGTTATTCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125830.3-1132s1c1
Sequence:CCGGGCCTCTTTGATCGAATATATACTCGAGTATATATTCGATCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks