EMAIL THIS PAGE TO A FRIEND

CPNE1

copine I

137 Gene Product Result for
Synonyms: COPN1 CPN1
UniProtKB ID: Q99829, E1P5Q4, Q6IBL3, Q9H243, Q9NTZ7
Gene ID:
Human(8904) Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene encodes a calcium-dependent protein that also contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. However, the encoded protein does not contain a predicted signal sequence or transmembrane domains. This protein has a broad tissue distribution and it may function in membrane trafficking. This gene and the gene for RNA binding motif protein 12 overlap at map location 20q11.21. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Aug 2008]
Mouse(266692) copine I
Rat(362249) copine I
cow(615677) copine I
Horse(100054882) copine I
dog(477213) copine I
chicken(419134) copine I
sheep(100302101) copine I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152928 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047151 MISSION® esiRNA esiRNA targeting mouse Cpne1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003915 Rosetta Predictions human pricing
NM_152925 Rosetta Predictions human pricing
NM_152926 Rosetta Predictions human pricing
NM_152927 Rosetta Predictions human pricing
NM_152928 Rosetta Predictions human pricing
NM_152929 Rosetta Predictions human pricing
NM_152930 Rosetta Predictions human pricing
NM_152931 Rosetta Predictions human pricing
XM_342555 Rosetta Predictions rat pricing
NM_170588 Rosetta Predictions mouse pricing
NM_170590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041657 predicted 1615
2 SASI_Hs01_00041658 predicted 1189
3 SASI_Hs01_00041659 predicted 1437
4 SASI_Hs01_00041660 predicted 1163
5 SASI_Hs01_00041661 predicted 1534
6 SASI_Hs01_00041662 predicted 1892
7 SASI_Hs01_00041663 predicted 770
8 SASI_Hs01_00041664 predicted 686
9 SASI_Hs02_00336552 predicted 1320
10 SASI_Hs01_00041665 predicted 1541
11 SASI_Hs01_00041666 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184712 predicted 1392
2 SASI_Hs01_00184713 predicted 968
3 SASI_Hs01_00184714 predicted 1214
4 SASI_Hs01_00184715 predicted 955
5 SASI_Hs01_00184716 predicted 1317
6 SASI_Hs01_00184717 predicted 1678
7 SASI_Hs01_00184718 predicted 554
8 SASI_Hs01_00184719 predicted 467
9 SASI_Hs02_00366922 predicted 1099
10 SASI_Hs01_00184720 predicted 1321
11 SASI_Hs01_00184721 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090549 predicted 1358
2 SASI_Hs01_00090550 predicted 927
3 SASI_Hs01_00090551 predicted 1176
4 SASI_Hs01_00090552 predicted 907
5 SASI_Hs01_00090553 predicted 1274
6 SASI_Hs01_00090554 predicted 1643
7 SASI_Hs01_00090555 predicted 517
8 SASI_Hs01_00090556 predicted 426
9 SASI_Hs02_00366923 predicted 1063
10 SASI_Hs01_00090557 predicted 1281
11 SASI_Hs01_00090558 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183340 predicted 1486
2 SASI_Hs01_00183341 predicted 1060
3 SASI_Hs01_00183342 predicted 1301
4 SASI_Hs01_00183343 predicted 1032
5 SASI_Hs01_00183344 predicted 1397
6 SASI_Hs01_00183345 predicted 1769
7 SASI_Hs01_00183346 predicted 647
8 SASI_Hs01_00183347 predicted 550
9 SASI_Hs02_00366924 predicted 1189
10 SASI_Hs01_00183348 predicted 1414
11 SASI_Hs01_00183349 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166254 predicted 1454
2 SASI_Hs01_00166255 predicted 1025
3 SASI_Hs01_00166256 predicted 1269
4 SASI_Hs01_00166257 predicted 1007
5 SASI_Hs01_00166258 predicted 1369
6 SASI_Hs01_00166259 predicted 1735
7 SASI_Hs01_00166260 predicted 606
8 SASI_Hs01_00166261 predicted 522
9 SASI_Hs02_00366925 predicted 1153
10 SASI_Hs01_00166262 predicted 1375
11 SASI_Hs01_00166263 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234816 predicted 1500
2 SASI_Hs01_00234817 predicted 1071
3 SASI_Hs01_00234818 predicted 1320
4 SASI_Hs01_00234819 predicted 1056
5 SASI_Hs01_00234820 predicted 1418
6 SASI_Hs01_00234821 predicted 1786
7 SASI_Hs01_00234822 predicted 662
8 SASI_Hs01_00234823 predicted 572
9 SASI_Hs02_00366926 predicted 1203
10 SASI_Hs01_00234824 predicted 1428
11 SASI_Hs01_00234825 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034079 predicted 1623
2 SASI_Hs01_00034080 predicted 1202
3 SASI_Hs01_00034081 predicted 1448
4 SASI_Hs01_00034082 predicted 1180
5 SASI_Hs01_00034083 predicted 1545
6 SASI_Hs01_00034084 predicted 1912
7 SASI_Hs01_00034085 predicted 788
8 SASI_Hs01_00034086 predicted 697
9 SASI_Hs02_00366927 predicted 1324
10 SASI_Hs01_00034087 predicted 1556
11 SASI_Hs01_00034088 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154550 predicted 1594
2 SASI_Hs01_00154551 predicted 1167
3 SASI_Hs01_00154552 predicted 1411
4 SASI_Hs01_00154553 predicted 1149
5 SASI_Hs01_00154554 predicted 1510
6 SASI_Hs01_00154555 predicted 1875
7 SASI_Hs01_00154556 predicted 758
8 SASI_Hs01_00154557 predicted 662
9 SASI_Hs02_00366928 predicted 1294
10 SASI_Hs01_00154558 predicted 1517
11 SASI_Hs01_00154559 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123852 predicted 636
2 SASI_Rn01_00123853 predicted 506
3 SASI_Rn01_00123854 predicted 577
4 SASI_Rn01_00123855 predicted 567
5 SASI_Rn01_00123856 predicted 371
6 SASI_Rn01_00123857 predicted 1245
7 SASI_Rn01_00123858 predicted 635
8 SASI_Rn01_00123859 predicted 1234
9 SASI_Rn01_00123860 predicted 588
10 SASI_Rn01_00123861 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082045 predicted 1207
2 SASI_Mm01_00082046 predicted 1214
3 SASI_Mm01_00082047 predicted 652
4 SASI_Mm01_00082048 predicted 1274
5 SASI_Mm01_00082049 predicted 513
6 SASI_Mm01_00082050 predicted 937
7 SASI_Mm01_00082051 predicted 1912
8 SASI_Mm01_00082052 predicted 1198
9 SASI_Mm01_00082053 predicted 1742
10 SASI_Mm01_00082054 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193540 predicted 1160
2 SASI_Mm01_00193541 predicted 1170
3 SASI_Mm01_00193542 predicted 602
4 SASI_Mm01_00193543 predicted 1223
5 SASI_Mm01_00193544 predicted 464
6 SASI_Mm01_00193545 predicted 887
7 SASI_Mm01_00193546 predicted 1861
8 SASI_Mm01_00193547 predicted 1150
9 SASI_Mm01_00193548 predicted 1691
10 SASI_Mm01_00193549 predicted 837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170590
VALIDATED
CPNE1 MISSION shRNA Bacterial Glycerol Stock
copine I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-1015s21c1
Sequence:CCGGGAGGCTGCCAGATCAACTTTACTCGAGTAAAGTTGATCTGGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-609s21c1
Sequence:CCGGGAAGCTAGAAACCTAGATAAGCTCGAGCTTATCTAGGTTTCTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170590.1-2047s21c1
Sequence:CCGGTAGATCCCTTTGGTCTAATAACTCGAGTTATTAGACCAAAGGGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-1078s21c1
Sequence:CCGGCACCTGACTCCCTGCATTATCCTCGAGGATAATGCAGGGAGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-2391s1c1
Sequence:CCGGGCCTGGAGTATAGTCTTGATTCTCGAGAATCAAGACTATACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-1173s1c1
Sequence:CCGGGACAAGCTATTTCCTGCATTTCTCGAGAAATGCAGGAAATAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-362s1c1
Sequence:CCGGGCAGATAGAATACCACTTTGACTCGAGTCAAAGTGGTATTCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-1104s1c1
Sequence:CCGGCCTACAGGAGTCAACGAGTATCTCGAGATACTCGTTGACTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-638s1c1
Sequence:CCGGCCTAGGGAAATCTGACCCATTCTCGAGAATGGGTCAGATTTCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170590
VALIDATED
CPNE1 MISSION shRNA shRNA Plasmid DNA
copine I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-1015s21c1
Sequence:CCGGGAGGCTGCCAGATCAACTTTACTCGAGTAAAGTTGATCTGGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-609s21c1
Sequence:CCGGGAAGCTAGAAACCTAGATAAGCTCGAGCTTATCTAGGTTTCTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170590.1-2047s21c1
Sequence:CCGGTAGATCCCTTTGGTCTAATAACTCGAGTTATTAGACCAAAGGGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-1078s21c1
Sequence:CCGGCACCTGACTCCCTGCATTATCCTCGAGGATAATGCAGGGAGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-2391s1c1
Sequence:CCGGGCCTGGAGTATAGTCTTGATTCTCGAGAATCAAGACTATACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-1173s1c1
Sequence:CCGGGACAAGCTATTTCCTGCATTTCTCGAGAAATGCAGGAAATAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-362s1c1
Sequence:CCGGGCAGATAGAATACCACTTTGACTCGAGTCAAAGTGGTATTCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-1104s1c1
Sequence:CCGGCCTACAGGAGTCAACGAGTATCTCGAGATACTCGTTGACTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-638s1c1
Sequence:CCGGCCTAGGGAAATCTGACCCATTCTCGAGAATGGGTCAGATTTCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170590
VALIDATED
CPNE1 MISSION shRNA Lentiviral Transduction Particles
copine I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-1015s21c1
Sequence:CCGGGAGGCTGCCAGATCAACTTTACTCGAGTAAAGTTGATCTGGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-609s21c1
Sequence:CCGGGAAGCTAGAAACCTAGATAAGCTCGAGCTTATCTAGGTTTCTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170590.1-2047s21c1
Sequence:CCGGTAGATCCCTTTGGTCTAATAACTCGAGTTATTAGACCAAAGGGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170590.1-1078s21c1
Sequence:CCGGCACCTGACTCCCTGCATTATCCTCGAGGATAATGCAGGGAGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-2391s1c1
Sequence:CCGGGCCTGGAGTATAGTCTTGATTCTCGAGAATCAAGACTATACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-1173s1c1
Sequence:CCGGGACAAGCTATTTCCTGCATTTCTCGAGAAATGCAGGAAATAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-362s1c1
Sequence:CCGGGCAGATAGAATACCACTTTGACTCGAGTCAAAGTGGTATTCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-1104s1c1
Sequence:CCGGCCTACAGGAGTCAACGAGTATCTCGAGATACTCGTTGACTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170590.1-638s1c1
Sequence:CCGGCCTAGGGAAATCTGACCCATTCTCGAGAATGGGTCAGATTTCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152928
VALIDATED
CPNE1 MISSION shRNA Bacterial Glycerol Stock
copine I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152928.1-652s21c1
Sequence:CCGGAGAGGCCAGAAACCTAGATAACTCGAGTTATCTAGGTTTCTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-443s21c1
Sequence:CCGGCGCTTTGGAATCTATGACATACTCGAGTATGTCATAGATTCCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-1275s21c1
Sequence:CCGGCGCATGAATTTGCCTTGAATTCTCGAGAATTCAAGGCAAATTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-845s21c1
Sequence:CCGGCAGGTGCAATGCTCCGATTATCTCGAGATAATCGGAGCATTGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152928.1-1886s1c1
Sequence:CCGGCTGGGCCACAACCCAACCCTTCTCGAGAAGGGTTGGGTTGTGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152928.1-1275s1c1
Sequence:CCGGCGCATGAATTTGCCTTGAATTCTCGAGAATTCAAGGCAAATTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152928.1-611s1c1
Sequence:CCGGGCTCAGGAATTAAAGGACAATCTCGAGATTGTCCTTTAATTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152928.1-443s1c1
Sequence:CCGGCGCTTTGGAATCTATGACATACTCGAGTATGTCATAGATTCCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152928.1-1652s1c1
Sequence:CCGGCGCGACATTGTGCAGTTTGTACTCGAGTACAAACTGCACAATGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152928
VALIDATED
CPNE1 MISSION shRNA shRNA Plasmid DNA
copine I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152928.1-652s21c1
Sequence:CCGGAGAGGCCAGAAACCTAGATAACTCGAGTTATCTAGGTTTCTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-443s21c1
Sequence:CCGGCGCTTTGGAATCTATGACATACTCGAGTATGTCATAGATTCCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-1275s21c1
Sequence:CCGGCGCATGAATTTGCCTTGAATTCTCGAGAATTCAAGGCAAATTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-845s21c1
Sequence:CCGGCAGGTGCAATGCTCCGATTATCTCGAGATAATCGGAGCATTGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152928.1-1886s1c1
Sequence:CCGGCTGGGCCACAACCCAACCCTTCTCGAGAAGGGTTGGGTTGTGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152928.1-1275s1c1
Sequence:CCGGCGCATGAATTTGCCTTGAATTCTCGAGAATTCAAGGCAAATTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152928.1-611s1c1
Sequence:CCGGGCTCAGGAATTAAAGGACAATCTCGAGATTGTCCTTTAATTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152928.1-443s1c1
Sequence:CCGGCGCTTTGGAATCTATGACATACTCGAGTATGTCATAGATTCCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152928.1-1652s1c1
Sequence:CCGGCGCGACATTGTGCAGTTTGTACTCGAGTACAAACTGCACAATGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152928
VALIDATED
CPNE1 MISSION shRNA Lentiviral Transduction Particles
copine I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152928.1-652s21c1
Sequence:CCGGAGAGGCCAGAAACCTAGATAACTCGAGTTATCTAGGTTTCTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-443s21c1
Sequence:CCGGCGCTTTGGAATCTATGACATACTCGAGTATGTCATAGATTCCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-1275s21c1
Sequence:CCGGCGCATGAATTTGCCTTGAATTCTCGAGAATTCAAGGCAAATTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152928.1-845s21c1
Sequence:CCGGCAGGTGCAATGCTCCGATTATCTCGAGATAATCGGAGCATTGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152928.1-1886s1c1
Sequence:CCGGCTGGGCCACAACCCAACCCTTCTCGAGAAGGGTTGGGTTGTGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152928.1-1275s1c1
Sequence:CCGGCGCATGAATTTGCCTTGAATTCTCGAGAATTCAAGGCAAATTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152928.1-611s1c1
Sequence:CCGGGCTCAGGAATTAAAGGACAATCTCGAGATTGTCCTTTAATTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152928.1-443s1c1
Sequence:CCGGCGCTTTGGAATCTATGACATACTCGAGTATGTCATAGATTCCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152928.1-1652s1c1
Sequence:CCGGCGCGACATTGTGCAGTTTGTACTCGAGTACAAACTGCACAATGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks