EMAIL THIS PAGE TO A FRIEND

CPNE2

copine II

96 Gene Product Result for
Synonyms: COPN2 CPN2
UniProtKB ID: Q96FN4, Q68D19, Q86XP9
Gene ID:
Human(221184) Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encode a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Sequence analysis identified multiple alternatively spliced transcript variants but their full-length natures could not be determined. [provided by RefSeq, Jul 2008]
Mouse(234577) copine II
Rat(498972) copine II
sheep(101121960) copine II
Zebrafish(565225) copine II
cow(782388) copine II
Horse(100052074) copine II
chicken(415646) copine II
dog(478115) copine II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041132 Anti-CPNE2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152727 Rosetta Predictions human pricing
XM_574259 Rosetta Predictions rat pricing
XR_009548 Rosetta Predictions rat pricing
NM_153507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156921 predicted 1068
2 SASI_Hs01_00156922 predicted 452
3 SASI_Hs01_00156923 predicted 786
4 SASI_Hs01_00156924 predicted 1441
5 SASI_Hs01_00156925 predicted 1073
6 SASI_Hs01_00156926 predicted 1720
7 SASI_Hs01_00156927 predicted 1337
8 SASI_Hs01_00156928 predicted 1216
9 SASI_Hs02_00366634 predicted 1252
10 SASI_Hs01_00156929 predicted 327
11 SASI_Hs01_00156930 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401664 predicted 1362
2 SASI_Rn02_00401665 predicted 440
3 SASI_Rn02_00401666 predicted 855
4 SASI_Rn02_00401667 predicted 1346
5 SASI_Rn02_00401668 predicted 984
6 SASI_Rn02_00401669 predicted 927
7 SASI_Rn02_00401670 predicted 660
8 SASI_Rn02_00401671 predicted 1221
9 SASI_Rn02_00401672 predicted 1162
10 SASI_Rn02_00401673 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181141 predicted 387
2 SASI_Rn01_00181142 predicted 312
3 SASI_Rn01_00181143 predicted 314
4 SASI_Rn01_00181144 predicted 530
5 SASI_Rn01_00181145 predicted 528
6 SASI_Rn01_00181146 predicted 500
7 SASI_Rn01_00181147 predicted 256
8 SASI_Rn01_00181148 predicted 614
9 SASI_Rn01_00181149 predicted 290
10 SASI_Rn01_00181150 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343253 predicted 423
2 SASI_Mm01_00049940 predicted 1081
3 SASI_Mm01_00049941 predicted 754
4 SASI_Mm01_00049942 predicted 1032
5 SASI_Mm01_00049943 predicted 764
6 SASI_Mm01_00049944 predicted 880
7 SASI_Mm01_00049945 predicted 1057
8 SASI_Mm01_00049946 predicted 829
9 SASI_Mm01_00049947 predicted 901
10 SASI_Mm01_00049949 predicted 1078
11 SASI_Mm01_00049948 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152727
VALIDATED
CPNE2 MISSION shRNA Bacterial Glycerol Stock
copine II
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1391s1c1
Sequence:CCGGTGCTCAGGTGTGGATGGTATTCTCGAGAATACCATCCACACCTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1264s1c1
Sequence:CCGGTGGGCAGATCATTCAGGACTACTCGAGTAGTCCTGAATGATCTGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-384s1c1
Sequence:CCGGCAGAGAACAATGGCAGATGGACTCGAGTCCATCTGCCATTGTTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1090s1c1
Sequence:CCGGCTGCAAGATAAACCGAGACTACTCGAGTAGTCTCGGTTTATCTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1198s1c1
Sequence:CCGGCCCTTCCTCTTTGCACTATATCTCGAGATATAGTGCAAAGAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1090s21c1
Sequence:CCGGCTGCAAGATAAACCGAGACTACTCGAGTAGTCTCGGTTTATCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1391s21c1
Sequence:CCGGTGCTCAGGTGTGGATGGTATTCTCGAGAATACCATCCACACCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1264s21c1
Sequence:CCGGTGGGCAGATCATTCAGGACTACTCGAGTAGTCCTGAATGATCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1198s21c1
Sequence:CCGGCCCTTCCTCTTTGCACTATATCTCGAGATATAGTGCAAAGAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152727
VALIDATED
CPNE2 MISSION shRNA shRNA Plasmid DNA
copine II
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1391s1c1
Sequence:CCGGTGCTCAGGTGTGGATGGTATTCTCGAGAATACCATCCACACCTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1264s1c1
Sequence:CCGGTGGGCAGATCATTCAGGACTACTCGAGTAGTCCTGAATGATCTGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-384s1c1
Sequence:CCGGCAGAGAACAATGGCAGATGGACTCGAGTCCATCTGCCATTGTTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1090s1c1
Sequence:CCGGCTGCAAGATAAACCGAGACTACTCGAGTAGTCTCGGTTTATCTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1198s1c1
Sequence:CCGGCCCTTCCTCTTTGCACTATATCTCGAGATATAGTGCAAAGAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1090s21c1
Sequence:CCGGCTGCAAGATAAACCGAGACTACTCGAGTAGTCTCGGTTTATCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1391s21c1
Sequence:CCGGTGCTCAGGTGTGGATGGTATTCTCGAGAATACCATCCACACCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1264s21c1
Sequence:CCGGTGGGCAGATCATTCAGGACTACTCGAGTAGTCCTGAATGATCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1198s21c1
Sequence:CCGGCCCTTCCTCTTTGCACTATATCTCGAGATATAGTGCAAAGAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152727
VALIDATED
CPNE2 MISSION shRNA Lentiviral Transduction Particles
copine II
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1391s1c1
Sequence:CCGGTGCTCAGGTGTGGATGGTATTCTCGAGAATACCATCCACACCTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1264s1c1
Sequence:CCGGTGGGCAGATCATTCAGGACTACTCGAGTAGTCCTGAATGATCTGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-384s1c1
Sequence:CCGGCAGAGAACAATGGCAGATGGACTCGAGTCCATCTGCCATTGTTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1090s1c1
Sequence:CCGGCTGCAAGATAAACCGAGACTACTCGAGTAGTCTCGGTTTATCTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152727.x-1198s1c1
Sequence:CCGGCCCTTCCTCTTTGCACTATATCTCGAGATATAGTGCAAAGAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1090s21c1
Sequence:CCGGCTGCAAGATAAACCGAGACTACTCGAGTAGTCTCGGTTTATCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1391s21c1
Sequence:CCGGTGCTCAGGTGTGGATGGTATTCTCGAGAATACCATCCACACCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1264s21c1
Sequence:CCGGTGGGCAGATCATTCAGGACTACTCGAGTAGTCCTGAATGATCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152727.4-1198s21c1
Sequence:CCGGCCCTTCCTCTTTGCACTATATCTCGAGATATAGTGCAAAGAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153507
CPNE2 MISSION shRNA Bacterial Glycerol Stock
copine II
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153507.2-2016s1c1
Sequence:CCGGGCTCCCTTTGTCAGAGTCAATCTCGAGATTGACTCTGACAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1170s1c1
Sequence:CCGGCGACCCTTCTTCTCTCCATTACTCGAGTAATGGAGAGAAGAAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1786s1c1
Sequence:CCGGCCTCAGCAAGTAGTGCAGTATCTCGAGATACTGCACTACTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-882s1c1
Sequence:CCGGCCAGGTTATGTGCTACGACTACTCGAGTAGTCGTAGCACATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1046s1c1
Sequence:CCGGGCATCATTATTCTGAGATCATCTCGAGATGATCTCAGAATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-513s21c1
Sequence:CCGGCCAGTTGGATGAGCATGATTTCTCGAGAAATCATGCTCATCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-1072s21c1
Sequence:CCGGATACACCGAAACTACTCATTCCTCGAGGAATGAGTAGTTTCGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-473s21c1
Sequence:CCGGAGCTCAAGTTCGCCCTGTTTGCTCGAGCAAACAGGGCGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-784s21c1
Sequence:CCGGCATAGGACCGAGGTGATTAAGCTCGAGCTTAATCACCTCGGTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153507.2-2076s21c1
Sequence:CCGGCCTCCTGCCACTCTAAGTATTCTCGAGAATACTTAGAGTGGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-892s21c1
Sequence:CCGGTGCTACGACTATGACAGTAATCTCGAGATTACTGTCATAGTCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153507
CPNE2 MISSION shRNA shRNA Plasmid DNA
copine II
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153507.2-2016s1c1
Sequence:CCGGGCTCCCTTTGTCAGAGTCAATCTCGAGATTGACTCTGACAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1170s1c1
Sequence:CCGGCGACCCTTCTTCTCTCCATTACTCGAGTAATGGAGAGAAGAAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1786s1c1
Sequence:CCGGCCTCAGCAAGTAGTGCAGTATCTCGAGATACTGCACTACTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-882s1c1
Sequence:CCGGCCAGGTTATGTGCTACGACTACTCGAGTAGTCGTAGCACATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1046s1c1
Sequence:CCGGGCATCATTATTCTGAGATCATCTCGAGATGATCTCAGAATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-513s21c1
Sequence:CCGGCCAGTTGGATGAGCATGATTTCTCGAGAAATCATGCTCATCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-1072s21c1
Sequence:CCGGATACACCGAAACTACTCATTCCTCGAGGAATGAGTAGTTTCGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-473s21c1
Sequence:CCGGAGCTCAAGTTCGCCCTGTTTGCTCGAGCAAACAGGGCGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-784s21c1
Sequence:CCGGCATAGGACCGAGGTGATTAAGCTCGAGCTTAATCACCTCGGTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153507.2-2076s21c1
Sequence:CCGGCCTCCTGCCACTCTAAGTATTCTCGAGAATACTTAGAGTGGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-892s21c1
Sequence:CCGGTGCTACGACTATGACAGTAATCTCGAGATTACTGTCATAGTCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153507
CPNE2 MISSION shRNA Lentiviral Transduction Particles
copine II
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153507.2-2016s1c1
Sequence:CCGGGCTCCCTTTGTCAGAGTCAATCTCGAGATTGACTCTGACAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1170s1c1
Sequence:CCGGCGACCCTTCTTCTCTCCATTACTCGAGTAATGGAGAGAAGAAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1786s1c1
Sequence:CCGGCCTCAGCAAGTAGTGCAGTATCTCGAGATACTGCACTACTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-882s1c1
Sequence:CCGGCCAGGTTATGTGCTACGACTACTCGAGTAGTCGTAGCACATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153507.2-1046s1c1
Sequence:CCGGGCATCATTATTCTGAGATCATCTCGAGATGATCTCAGAATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-513s21c1
Sequence:CCGGCCAGTTGGATGAGCATGATTTCTCGAGAAATCATGCTCATCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-1072s21c1
Sequence:CCGGATACACCGAAACTACTCATTCCTCGAGGAATGAGTAGTTTCGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-473s21c1
Sequence:CCGGAGCTCAAGTTCGCCCTGTTTGCTCGAGCAAACAGGGCGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-784s21c1
Sequence:CCGGCATAGGACCGAGGTGATTAAGCTCGAGCTTAATCACCTCGGTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153507.2-2076s21c1
Sequence:CCGGCCTCCTGCCACTCTAAGTATTCTCGAGAATACTTAGAGTGGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153507.2-892s21c1
Sequence:CCGGTGCTACGACTATGACAGTAATCTCGAGATTACTGTCATAGTCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks