EMAIL THIS PAGE TO A FRIEND

CPNE3

copine III

63 Gene Product Result for
Synonyms: CPN3 PRO1071
UniProtKB ID: O75131, A8KA47, Q8IYA1
Gene ID:
Human(8895) Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene encodes a protein which contains two type II C2 domains in the amino-terminus and an A domain-like sequence in the carboxy-terminus. The A domain mediates interactions between integrins and extracellular ligands. [provided by RefSeq, Aug 2008]
Mouse(70568) copine III
Rat(313087) copine III
Zebrafish(393136) copine III
cow(615304) copine III
chicken(420214) copine III
dog(487034) copine III
sheep(101116917) copine III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003909 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003909 Rosetta Predictions human pricing
NM_001107917 Rosetta Predictions rat pricing
NM_027769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225474 predicted 1219
2 SASI_Hs01_00225475 predicted 523
3 SASI_Hs01_00225476 predicted 1455
4 SASI_Hs01_00225477 predicted 1138
5 SASI_Hs02_00336540 predicted 1816
6 SASI_Hs02_00336541 predicted 349
7 SASI_Hs01_00225479 predicted 1484
8 SASI_Hs01_00225480 predicted 1694
9 SASI_Hs01_00225481 predicted 594
10 SASI_Hs01_00225482 predicted 440
11 SASI_Hs01_00225478 predicted 292
12 SASI_Hs01_00225483 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233555 predicted 329
2 SASI_Rn02_00233556 predicted 323
3 SASI_Rn02_00233557 predicted 518
4 SASI_Rn02_00233558 predicted 539
5 SASI_Rn02_00233559 predicted 335
6 SASI_Rn02_00233560 predicted 543
7 SASI_Rn02_00233561 predicted 280
8 SASI_Rn02_00233562 predicted 292
9 SASI_Rn02_00233563 predicted 526
10 SASI_Rn02_00233564 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111193 predicted 342
2 SASI_Mm01_00111194 predicted 283
3 SASI_Mm02_00332711 predicted 332
4 SASI_Mm01_00111195 predicted 1803
5 SASI_Mm01_00111196 predicted 483
6 SASI_Mm01_00111197 predicted 414
7 SASI_Mm01_00111198 predicted 1088
8 SASI_Mm01_00111199 predicted 1097
9 SASI_Mm01_00111200 predicted 597
10 SASI_Mm01_00111201 predicted 1181
11 SASI_Mm01_00111202 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003909
VALIDATED
CPNE3 MISSION shRNA Bacterial Glycerol Stock
copine III
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003909.3-1915s21c1
Sequence:GTACCGGAGCATTCTTTCTAGGTTATTTCTCGAGAAATAACCTAGAAAGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-302s21c1
Sequence:CCGGGCACAGAAAGGATTAAGAATTCTCGAGAATTCTTAATCCTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1332s21c1
Sequence:CCGGACTCTATGGACCAACTAATTTCTCGAGAAATTAGTTGGTCCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1754s21c1
Sequence:CCGGCCACGAAACAACAGAAGCAGTCTCGAGACTGCTTCTGTTGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1270s21c1
Sequence:CCGGCCCTACTGCAATGGAATCCAACTCGAGTTGGATTCCATTGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003909.3-2183s21c1
Sequence:GTACCGGGCCAATGTCCATACCTGATTACTCGAGTAATCAGGTATGGACATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003909.x-4148s1c1
Sequence:CCGGCCATTCATTTAAGTGCTGTTTCTCGAGAAACAGCACTTAAATGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003909.x-260s1c1
Sequence:CCGGGCACAGAAAGGATTAAGAATTCTCGAGAATTCTTAATCCTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003909.x-202s1c1
Sequence:CCGGGACCCTTTATGTGTGTTGTTTCTCGAGAAACAACACACATAAAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003909.x-1228s1c1
Sequence:CCGGCCCTACTGCAATGGAATCCAACTCGAGTTGGATTCCATTGCAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003909
VALIDATED
CPNE3 MISSION shRNA shRNA Plasmid DNA
copine III
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003909.3-1915s21c1
Sequence:GTACCGGAGCATTCTTTCTAGGTTATTTCTCGAGAAATAACCTAGAAAGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-302s21c1
Sequence:CCGGGCACAGAAAGGATTAAGAATTCTCGAGAATTCTTAATCCTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1332s21c1
Sequence:CCGGACTCTATGGACCAACTAATTTCTCGAGAAATTAGTTGGTCCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1754s21c1
Sequence:CCGGCCACGAAACAACAGAAGCAGTCTCGAGACTGCTTCTGTTGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1270s21c1
Sequence:CCGGCCCTACTGCAATGGAATCCAACTCGAGTTGGATTCCATTGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003909.3-2183s21c1
Sequence:GTACCGGGCCAATGTCCATACCTGATTACTCGAGTAATCAGGTATGGACATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003909.x-4148s1c1
Sequence:CCGGCCATTCATTTAAGTGCTGTTTCTCGAGAAACAGCACTTAAATGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003909.x-260s1c1
Sequence:CCGGGCACAGAAAGGATTAAGAATTCTCGAGAATTCTTAATCCTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003909.x-202s1c1
Sequence:CCGGGACCCTTTATGTGTGTTGTTTCTCGAGAAACAACACACATAAAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003909.x-1228s1c1
Sequence:CCGGCCCTACTGCAATGGAATCCAACTCGAGTTGGATTCCATTGCAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003909
VALIDATED
CPNE3 MISSION shRNA Lentiviral Transduction Particles
copine III
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003909.3-1915s21c1
Sequence:GTACCGGAGCATTCTTTCTAGGTTATTTCTCGAGAAATAACCTAGAAAGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-302s21c1
Sequence:CCGGGCACAGAAAGGATTAAGAATTCTCGAGAATTCTTAATCCTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1332s21c1
Sequence:CCGGACTCTATGGACCAACTAATTTCTCGAGAAATTAGTTGGTCCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1754s21c1
Sequence:CCGGCCACGAAACAACAGAAGCAGTCTCGAGACTGCTTCTGTTGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003909.3-1270s21c1
Sequence:CCGGCCCTACTGCAATGGAATCCAACTCGAGTTGGATTCCATTGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003909.3-2183s21c1
Sequence:GTACCGGGCCAATGTCCATACCTGATTACTCGAGTAATCAGGTATGGACATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003909.x-4148s1c1
Sequence:CCGGCCATTCATTTAAGTGCTGTTTCTCGAGAAACAGCACTTAAATGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003909.x-260s1c1
Sequence:CCGGGCACAGAAAGGATTAAGAATTCTCGAGAATTCTTAATCCTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003909.x-202s1c1
Sequence:CCGGGACCCTTTATGTGTGTTGTTTCTCGAGAAACAACACACATAAAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003909.x-1228s1c1
Sequence:CCGGCCCTACTGCAATGGAATCCAACTCGAGTTGGATTCCATTGCAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027769
VALIDATED
CPNE3 MISSION shRNA Bacterial Glycerol Stock
copine III
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-478s21c1
Sequence:CCGGTGCAGGGAAAGGGAGTATTACCTCGAGGTAATACTCCCTTTCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-1090s21c1
Sequence:CCGGCTGGTCTGTAGGATTGGTAATCTCGAGATTACCAATCCTACAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-2883s21c1
Sequence:CCGGTAGGCATAAAGCCTGATATAACTCGAGTTATATCAGGCTTTATGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-1282s21c1
Sequence:CCGGACTCTATGGACCAACTAATTTCTCGAGAAATTAGTTGGTCCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-642s21c1
Sequence:CCGGTTCACCGAACAGAGGTTATAACTCGAGTTATAACCTCTGTTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027769.2-3463s1c1
Sequence:CCGGCCCAGCTTAAATACAAACTAACTCGAGTTAGTTTGTATTTAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-842s1c1
Sequence:CCGGCCTGTTGAATATGAATGCATACTCGAGTATGCATTCATATTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-778s1c1
Sequence:CCGGGCATGATCTCATTGGAACATTCTCGAGAATGTTCCAATGAGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-1198s1c1
Sequence:CCGGGATGAACTTTAACCCATCGAACTCGAGTTCGATGGGTTAAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-1354s1c1
Sequence:CCGGGCAGACAGCTTCTCAATACTTCTCGAGAAGTATTGAGAAGCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027769
VALIDATED
CPNE3 MISSION shRNA shRNA Plasmid DNA
copine III
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-478s21c1
Sequence:CCGGTGCAGGGAAAGGGAGTATTACCTCGAGGTAATACTCCCTTTCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-1090s21c1
Sequence:CCGGCTGGTCTGTAGGATTGGTAATCTCGAGATTACCAATCCTACAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-2883s21c1
Sequence:CCGGTAGGCATAAAGCCTGATATAACTCGAGTTATATCAGGCTTTATGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-1282s21c1
Sequence:CCGGACTCTATGGACCAACTAATTTCTCGAGAAATTAGTTGGTCCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-642s21c1
Sequence:CCGGTTCACCGAACAGAGGTTATAACTCGAGTTATAACCTCTGTTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027769.2-3463s1c1
Sequence:CCGGCCCAGCTTAAATACAAACTAACTCGAGTTAGTTTGTATTTAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-842s1c1
Sequence:CCGGCCTGTTGAATATGAATGCATACTCGAGTATGCATTCATATTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-778s1c1
Sequence:CCGGGCATGATCTCATTGGAACATTCTCGAGAATGTTCCAATGAGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-1198s1c1
Sequence:CCGGGATGAACTTTAACCCATCGAACTCGAGTTCGATGGGTTAAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-1354s1c1
Sequence:CCGGGCAGACAGCTTCTCAATACTTCTCGAGAAGTATTGAGAAGCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027769
VALIDATED
CPNE3 MISSION shRNA Lentiviral Transduction Particles
copine III
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-478s21c1
Sequence:CCGGTGCAGGGAAAGGGAGTATTACCTCGAGGTAATACTCCCTTTCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-1090s21c1
Sequence:CCGGCTGGTCTGTAGGATTGGTAATCTCGAGATTACCAATCCTACAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-2883s21c1
Sequence:CCGGTAGGCATAAAGCCTGATATAACTCGAGTTATATCAGGCTTTATGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-1282s21c1
Sequence:CCGGACTCTATGGACCAACTAATTTCTCGAGAAATTAGTTGGTCCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027769.2-642s21c1
Sequence:CCGGTTCACCGAACAGAGGTTATAACTCGAGTTATAACCTCTGTTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027769.2-3463s1c1
Sequence:CCGGCCCAGCTTAAATACAAACTAACTCGAGTTAGTTTGTATTTAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-842s1c1
Sequence:CCGGCCTGTTGAATATGAATGCATACTCGAGTATGCATTCATATTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-778s1c1
Sequence:CCGGGCATGATCTCATTGGAACATTCTCGAGAATGTTCCAATGAGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-1198s1c1
Sequence:CCGGGATGAACTTTAACCCATCGAACTCGAGTTCGATGGGTTAAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027769.2-1354s1c1
Sequence:CCGGGCAGACAGCTTCTCAATACTTCTCGAGAAGTATTGAGAAGCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks