EMAIL THIS PAGE TO A FRIEND

CPNE4

copine IV

96 Gene Product Result for
Synonyms: COPN4 CPN4
UniProtKB ID: Q96A23, D3DNC5, Q8TEX1
Gene ID:
Human(131034) Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encode a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Mouse(74020) copine IV
Rat(367160) copine IV
sheep(101120625) copine IV
Horse(100052810) copine IV
chicken(420687) copine IV
dog(485661) copine IV
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408312 Anti-CPNE4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV52544 Anti-CPNE4 antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, mouse, rabbit, horse
western blot pricing
SAB2103985 Anti-CPNE4, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, zebrafish, human, guinea pig, rat, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130808 Rosetta Predictions human pricing
NM_001109003 Rosetta Predictions rat pricing
NM_028719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362844 predicted 703
2 SASI_Hs01_00056813 predicted 943
3 SASI_Hs01_00056814 predicted 626
4 SASI_Hs01_00056815 predicted 1350
5 SASI_Hs01_00056816 predicted 1158
6 SASI_Hs01_00056817 predicted 1549
7 SASI_Hs01_00056819 predicted 1856
8 SASI_Hs02_00362845 predicted 2032
9 SASI_Hs01_00056820 predicted 979
10 SASI_Hs01_00056822 predicted 1268
11 SASI_Hs01_00056818 predicted 866
12 SASI_Hs01_00056821 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244214 predicted 1957
2 SASI_Rn02_00244215 predicted 1458
3 SASI_Rn02_00244216 predicted 1864
4 SASI_Rn02_00244217 predicted 2291
5 SASI_Rn02_00244218 predicted 1659
6 SASI_Rn02_00244219 predicted 1266
7 SASI_Rn02_00244220 predicted 949
8 SASI_Rn02_00244221 predicted 1828
9 SASI_Rn02_00244222 predicted 1751
10 SASI_Rn02_00244223 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086598 predicted 930
2 SASI_Mm01_00086599 predicted 1768
3 SASI_Mm02_00334272 predicted 1039
4 SASI_Mm02_00334273 predicted 1434
5 SASI_Mm01_00086600 predicted 944
6 SASI_Mm01_00086601 predicted 404
7 SASI_Mm01_00086602 predicted 1414
8 SASI_Mm01_00086603 predicted 1609
9 SASI_Mm01_00086604 predicted 505
10 SASI_Mm01_00086605 predicted 801
11 SASI_Mm01_00086606 predicted 1228
12 SASI_Mm01_00086607 predicted 1173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130808
VALIDATED
CPNE4 MISSION shRNA Bacterial Glycerol Stock
copine IV
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-1725s1c1
Sequence:CCGGCAAGGAGGCATCGCAATACTTCTCGAGAAGTATTGCGATGCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-544s1c1
Sequence:CCGGGACAGAGATGCCCTTTCCAAACTCGAGTTTGGAAAGGGCATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-708s1c1
Sequence:CCGGGCGGTTTGAAGTCCATGACATCTCGAGATGTCATGGACTTCAAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-813s1c1
Sequence:CCGGGCTGTCCAAATCCTTGCTGAACTCGAGTTCAGCAAGGATTTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-791s1c1
Sequence:CCGGGCCAGATTGTTTCCCAGAGAACTCGAGTTCTCTGGGAAACAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-1609s1c1
Sequence:CCGGCAAGGAGTTGTGGAAGCCTATCTCGAGATAGGCTTCCACAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130808.1-1428s1c1
Sequence:CCGGCCCTTACCAACCCAATGAGTACTCGAGTACTCATTGGGTTGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1107s21c1
Sequence:CCGGCCGGCTAAAGTGCATAGTATGCTCGAGCATACTATGCACTTTAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1019s21c1
Sequence:CCGGGAACTGAGGTTGTGATGAATACTCGAGTATTCATCACAACCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130808.1-2141s21c1
Sequence:CCGGTACTATTCCTGCTAATATTTCCTCGAGGAAATATTAGCAGGAATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-2018s21c1
Sequence:CCGGCAAACCAAGTTGTGGACTATTCTCGAGAATAGTCCACAACTTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-913s21c1
Sequence:CCGGGCATTCAATGCACGGAAATTGCTCGAGCAATTTCCGTGCATTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130808.1-2288s21c1
Sequence:CCGGGATCTGTTAAGCCCTTGTATTCTCGAGAATACAAGGGCTTAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1068s21c1
Sequence:CCGGAGTATCTGTAAATTCTCTATGCTCGAGCATAGAGAATTTACAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130808
VALIDATED
CPNE4 MISSION shRNA shRNA Plasmid DNA
copine IV
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-1725s1c1
Sequence:CCGGCAAGGAGGCATCGCAATACTTCTCGAGAAGTATTGCGATGCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-544s1c1
Sequence:CCGGGACAGAGATGCCCTTTCCAAACTCGAGTTTGGAAAGGGCATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-708s1c1
Sequence:CCGGGCGGTTTGAAGTCCATGACATCTCGAGATGTCATGGACTTCAAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-813s1c1
Sequence:CCGGGCTGTCCAAATCCTTGCTGAACTCGAGTTCAGCAAGGATTTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-791s1c1
Sequence:CCGGGCCAGATTGTTTCCCAGAGAACTCGAGTTCTCTGGGAAACAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-1609s1c1
Sequence:CCGGCAAGGAGTTGTGGAAGCCTATCTCGAGATAGGCTTCCACAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130808.1-1428s1c1
Sequence:CCGGCCCTTACCAACCCAATGAGTACTCGAGTACTCATTGGGTTGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1107s21c1
Sequence:CCGGCCGGCTAAAGTGCATAGTATGCTCGAGCATACTATGCACTTTAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1019s21c1
Sequence:CCGGGAACTGAGGTTGTGATGAATACTCGAGTATTCATCACAACCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130808.1-2141s21c1
Sequence:CCGGTACTATTCCTGCTAATATTTCCTCGAGGAAATATTAGCAGGAATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-2018s21c1
Sequence:CCGGCAAACCAAGTTGTGGACTATTCTCGAGAATAGTCCACAACTTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-913s21c1
Sequence:CCGGGCATTCAATGCACGGAAATTGCTCGAGCAATTTCCGTGCATTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130808.1-2288s21c1
Sequence:CCGGGATCTGTTAAGCCCTTGTATTCTCGAGAATACAAGGGCTTAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1068s21c1
Sequence:CCGGAGTATCTGTAAATTCTCTATGCTCGAGCATAGAGAATTTACAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130808
VALIDATED
CPNE4 MISSION shRNA Lentiviral Transduction Particles
copine IV
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-1725s1c1
Sequence:CCGGCAAGGAGGCATCGCAATACTTCTCGAGAAGTATTGCGATGCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-544s1c1
Sequence:CCGGGACAGAGATGCCCTTTCCAAACTCGAGTTTGGAAAGGGCATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-708s1c1
Sequence:CCGGGCGGTTTGAAGTCCATGACATCTCGAGATGTCATGGACTTCAAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-813s1c1
Sequence:CCGGGCTGTCCAAATCCTTGCTGAACTCGAGTTCAGCAAGGATTTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_130808.1-791s1c1
Sequence:CCGGGCCAGATTGTTTCCCAGAGAACTCGAGTTCTCTGGGAAACAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130808.1-1609s1c1
Sequence:CCGGCAAGGAGTTGTGGAAGCCTATCTCGAGATAGGCTTCCACAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130808.1-1428s1c1
Sequence:CCGGCCCTTACCAACCCAATGAGTACTCGAGTACTCATTGGGTTGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1107s21c1
Sequence:CCGGCCGGCTAAAGTGCATAGTATGCTCGAGCATACTATGCACTTTAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1019s21c1
Sequence:CCGGGAACTGAGGTTGTGATGAATACTCGAGTATTCATCACAACCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130808.1-2141s21c1
Sequence:CCGGTACTATTCCTGCTAATATTTCCTCGAGGAAATATTAGCAGGAATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-2018s21c1
Sequence:CCGGCAAACCAAGTTGTGGACTATTCTCGAGAATAGTCCACAACTTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-913s21c1
Sequence:CCGGGCATTCAATGCACGGAAATTGCTCGAGCAATTTCCGTGCATTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130808.1-2288s21c1
Sequence:CCGGGATCTGTTAAGCCCTTGTATTCTCGAGAATACAAGGGCTTAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130808.1-1068s21c1
Sequence:CCGGAGTATCTGTAAATTCTCTATGCTCGAGCATAGAGAATTTACAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135115
CPNE4 MISSION shRNA Bacterial Glycerol Stock
copine IV
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1294s1c1
Sequence:CCGGCCTGCACTATATCCACCCTTACTCGAGTAAGGGTGGATATAGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1221s1c1
Sequence:CCGGGCGGCTGTCAAATCCAGTTTACTCGAGTAAACTGGATTTGACAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-755s1c1
Sequence:CCGGGCTGAAGAATTATCGGGCAATCTCGAGATTGCCCGATAATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-451s1c1
Sequence:CCGGCCCTTGTGTCATCCTCAAGATCTCGAGATCTTGAGGATGACACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1909s1c1
Sequence:CCGGCGTAGACTATTACAATGGTAACTCGAGTTACCATTGTAATAGTCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135115
CPNE4 MISSION shRNA shRNA Plasmid DNA
copine IV
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1294s1c1
Sequence:CCGGCCTGCACTATATCCACCCTTACTCGAGTAAGGGTGGATATAGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1221s1c1
Sequence:CCGGGCGGCTGTCAAATCCAGTTTACTCGAGTAAACTGGATTTGACAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-755s1c1
Sequence:CCGGGCTGAAGAATTATCGGGCAATCTCGAGATTGCCCGATAATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-451s1c1
Sequence:CCGGCCCTTGTGTCATCCTCAAGATCTCGAGATCTTGAGGATGACACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1909s1c1
Sequence:CCGGCGTAGACTATTACAATGGTAACTCGAGTTACCATTGTAATAGTCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135115
CPNE4 MISSION shRNA Lentiviral Transduction Particles
copine IV
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1294s1c1
Sequence:CCGGCCTGCACTATATCCACCCTTACTCGAGTAAGGGTGGATATAGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1221s1c1
Sequence:CCGGGCGGCTGTCAAATCCAGTTTACTCGAGTAAACTGGATTTGACAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-755s1c1
Sequence:CCGGGCTGAAGAATTATCGGGCAATCTCGAGATTGCCCGATAATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-451s1c1
Sequence:CCGGCCCTTGTGTCATCCTCAAGATCTCGAGATCTTGAGGATGACACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135115.2-1909s1c1
Sequence:CCGGCGTAGACTATTACAATGGTAACTCGAGTTACCATTGTAATAGTCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks