EMAIL THIS PAGE TO A FRIEND

CPNE5

copine V

60 Gene Product Result for
Synonyms: COPN5 CPN5
UniProtKB ID: Q9HCH3
Gene ID:
Human(57699) Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encode a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Sequence analysis identified multiple alternatively spliced transcript variants but their full-length natures could not be determined. [provided by RefSeq, Jul 2008]
Mouse(240058) copine V
Rat(309650) copine V
cow(508482) copine V
dog(481768) copine V
sheep(101102679) copine V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020939 Rosetta Predictions human pricing
NM_001107616 Rosetta Predictions rat pricing
NM_153166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043510 predicted 359
2 SASI_Hs02_00354331 predicted 1262
3 SASI_Hs01_00043512 predicted 283
4 SASI_Hs01_00043513 predicted 553
5 SASI_Hs02_00354332 predicted 601
6 SASI_Hs01_00043514 predicted 240
7 SASI_Hs01_00043515 predicted 459
8 SASI_Hs01_00043517 predicted 1610
9 SASI_Hs01_00043518 predicted 1996
10 SASI_Hs01_00043519 predicted 301
11 SASI_Hs01_00043511 predicted 377
12 SASI_Hs01_00043516 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230585 predicted 2260
2 SASI_Rn02_00230586 predicted 264
3 SASI_Rn02_00230587 predicted 399
4 SASI_Rn02_00230588 predicted 1999
5 SASI_Rn02_00230589 predicted 2265
6 SASI_Rn02_00230590 predicted 739
7 SASI_Rn02_00230591 predicted 718
8 SASI_Rn02_00230592 predicted 1945
9 SASI_Rn02_00230593 predicted 513
10 SASI_Rn02_00230594 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343076 predicted 364
2 SASI_Mm01_00193250 predicted 647
3 SASI_Mm01_00193251 predicted 1379
4 SASI_Mm01_00193252 predicted 1538
5 SASI_Mm01_00193253 predicted 323
6 SASI_Mm01_00193254 predicted 639
7 SASI_Mm01_00193255 predicted 731
8 SASI_Mm01_00193256 predicted 327
9 SASI_Mm01_00193257 predicted 719
10 SASI_Mm01_00193258 predicted 706
11 SASI_Mm01_00193259 predicted 1534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153166
CPNE5 MISSION shRNA Bacterial Glycerol Stock
copine V
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-248s21c1
Sequence:CCGGGAACAAGCAATGGCGAGAGTTCTCGAGAACTCTCGCCATTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-154s21c1
Sequence:CCGGAGGTGGAGATCACGGTGTCATCTCGAGATGACACCGTGATCTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-1190s21c1
Sequence:CCGGCATTCAGCATTATGACAGTGACTCGAGTCACTGTCATAATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153166.1-2885s1c1
Sequence:CCGGCGCATGGTGATAGTGATGTTTCTCGAGAAACATCACTATCACCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-490s1c1
Sequence:CCGGGCCTCTCACGATAGGAACATTCTCGAGAATGTTCCTATCGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-647s1c1
Sequence:CCGGGCCAACAAGCTGGATAAGAAACTCGAGTTTCTTATCCAGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-1385s1c1
Sequence:CCGGCCCACTAACTTTGCTCCTGTTCTCGAGAACAGGAGCAAAGTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-1538s1c1
Sequence:CCGGCCTATGTCGATCATCATTGTTCTCGAGAACAATGATGATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153166
CPNE5 MISSION shRNA shRNA Plasmid DNA
copine V
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-248s21c1
Sequence:CCGGGAACAAGCAATGGCGAGAGTTCTCGAGAACTCTCGCCATTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-154s21c1
Sequence:CCGGAGGTGGAGATCACGGTGTCATCTCGAGATGACACCGTGATCTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-1190s21c1
Sequence:CCGGCATTCAGCATTATGACAGTGACTCGAGTCACTGTCATAATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153166.1-2885s1c1
Sequence:CCGGCGCATGGTGATAGTGATGTTTCTCGAGAAACATCACTATCACCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-490s1c1
Sequence:CCGGGCCTCTCACGATAGGAACATTCTCGAGAATGTTCCTATCGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-647s1c1
Sequence:CCGGGCCAACAAGCTGGATAAGAAACTCGAGTTTCTTATCCAGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-1385s1c1
Sequence:CCGGCCCACTAACTTTGCTCCTGTTCTCGAGAACAGGAGCAAAGTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-1538s1c1
Sequence:CCGGCCTATGTCGATCATCATTGTTCTCGAGAACAATGATGATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153166
CPNE5 MISSION shRNA Lentiviral Transduction Particles
copine V
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-248s21c1
Sequence:CCGGGAACAAGCAATGGCGAGAGTTCTCGAGAACTCTCGCCATTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-154s21c1
Sequence:CCGGAGGTGGAGATCACGGTGTCATCTCGAGATGACACCGTGATCTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153166.2-1190s21c1
Sequence:CCGGCATTCAGCATTATGACAGTGACTCGAGTCACTGTCATAATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153166.1-2885s1c1
Sequence:CCGGCGCATGGTGATAGTGATGTTTCTCGAGAAACATCACTATCACCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-490s1c1
Sequence:CCGGGCCTCTCACGATAGGAACATTCTCGAGAATGTTCCTATCGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-647s1c1
Sequence:CCGGGCCAACAAGCTGGATAAGAAACTCGAGTTTCTTATCCAGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-1385s1c1
Sequence:CCGGCCCACTAACTTTGCTCCTGTTCTCGAGAACAGGAGCAAAGTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153166.1-1538s1c1
Sequence:CCGGCCTATGTCGATCATCATTGTTCTCGAGAACAATGATGATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020939
CPNE5 MISSION shRNA Bacterial Glycerol Stock
copine V
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020939.1-266s1c1
Sequence:CCGGGTCATCGACAACACGCTCAATCTCGAGATTGAGCGTGTTGTCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2807s1c1
Sequence:CCGGGCCTCAGTTTCCATGTCTGTACTCGAGTACAGACATGGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2910s1c1
Sequence:CCGGCCCATCCTACTCCTAACAGATCTCGAGATCTGTTAGGAGTAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2168s1c1
Sequence:CCGGCCCGGCAATCCTATTTGCTTACTCGAGTAAGCAAATAGGATTGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-910s1c1
Sequence:CCGGCAACATCTATGAGGTGGTAAACTCGAGTTTACCACCTCATAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-725s1c1
Sequence:CCGGGTCATGAAGAACACCCTAAATCTCGAGATTTAGGGTGTTCTTCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-300s1c1
Sequence:CCGGGCAAGTTCATTGTGGATTACTCTCGAGAGTAATCCACAATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-377s1c1
Sequence:CCGGCCTGATTTATCCAAACACGATCTCGAGATCGTGTTTGGATAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2119s1c1
Sequence:CCGGGCCAGGAAGGTGTAAACAATACTCGAGTATTGTTTACACCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020939
CPNE5 MISSION shRNA shRNA Plasmid DNA
copine V
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020939.1-266s1c1
Sequence:CCGGGTCATCGACAACACGCTCAATCTCGAGATTGAGCGTGTTGTCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2807s1c1
Sequence:CCGGGCCTCAGTTTCCATGTCTGTACTCGAGTACAGACATGGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2910s1c1
Sequence:CCGGCCCATCCTACTCCTAACAGATCTCGAGATCTGTTAGGAGTAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2168s1c1
Sequence:CCGGCCCGGCAATCCTATTTGCTTACTCGAGTAAGCAAATAGGATTGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-910s1c1
Sequence:CCGGCAACATCTATGAGGTGGTAAACTCGAGTTTACCACCTCATAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-725s1c1
Sequence:CCGGGTCATGAAGAACACCCTAAATCTCGAGATTTAGGGTGTTCTTCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-300s1c1
Sequence:CCGGGCAAGTTCATTGTGGATTACTCTCGAGAGTAATCCACAATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-377s1c1
Sequence:CCGGCCTGATTTATCCAAACACGATCTCGAGATCGTGTTTGGATAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2119s1c1
Sequence:CCGGGCCAGGAAGGTGTAAACAATACTCGAGTATTGTTTACACCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020939
CPNE5 MISSION shRNA Lentiviral Transduction Particles
copine V
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020939.1-266s1c1
Sequence:CCGGGTCATCGACAACACGCTCAATCTCGAGATTGAGCGTGTTGTCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2807s1c1
Sequence:CCGGGCCTCAGTTTCCATGTCTGTACTCGAGTACAGACATGGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2910s1c1
Sequence:CCGGCCCATCCTACTCCTAACAGATCTCGAGATCTGTTAGGAGTAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2168s1c1
Sequence:CCGGCCCGGCAATCCTATTTGCTTACTCGAGTAAGCAAATAGGATTGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-910s1c1
Sequence:CCGGCAACATCTATGAGGTGGTAAACTCGAGTTTACCACCTCATAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-725s1c1
Sequence:CCGGGTCATGAAGAACACCCTAAATCTCGAGATTTAGGGTGTTCTTCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-300s1c1
Sequence:CCGGGCAAGTTCATTGTGGATTACTCTCGAGAGTAATCCACAATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020939.1-377s1c1
Sequence:CCGGCCTGATTTATCCAAACACGATCTCGAGATCGTGTTTGGATAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020939.1-2119s1c1
Sequence:CCGGGCCAGGAAGGTGTAAACAATACTCGAGTATTGTTTACACCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks