EMAIL THIS PAGE TO A FRIEND

CPNE6

copine VI (neuronal)

79 Gene Product Result for
UniProtKB ID: O95741, B2RAG6, D3DS55, Q53HA6, Q8WVG1
Gene ID:
Human(9362) Summary: This gene encodes a brain-specific member of the copine family, which is composed of calcium-dependent membrane-binding proteins. The gene product contains two N-terminal C2 domains, and one von Willebrand factor A domain. It may have a role in synaptic plasticity. [provided by RefSeq, Jul 2008]
Mouse(12891) copine VI
Rat(691478) copine VI (neuronal)
sheep(101118614) copine VI (neuronal)
Domestic Rabbit(100342224) copine VI (neuronal)
domestic guinea pig(100717208) copine VI (neuronal)
naked mole-rat(101706959) copine VI (neuronal)
dog(608275) copine VI (neuronal)
domestic cat(101098638) copine VI (neuronal)
cow(508059) copine VI (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006032 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034501 MISSION® esiRNA esiRNA human CPNE6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006032 Rosetta Predictions human pricing
XM_001078470 Rosetta Predictions rat pricing
NM_009947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143798 predicted 966
2 SASI_Hs01_00143800 predicted 421
3 SASI_Hs01_00143801 predicted 438
4 SASI_Hs01_00143802 predicted 1445
5 SASI_Hs01_00143803 predicted 512
6 SASI_Hs01_00143804 predicted 742
7 SASI_Hs01_00143805 predicted 282
8 SASI_Hs01_00143806 predicted 573
9 SASI_Hs02_00340764 predicted 973
10 SASI_Hs02_00340765 predicted 650
11 SASI_Hs01_00143797 predicted 577
12 SASI_Hs01_00143799 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360877 predicted 966
2 SASI_Rn02_00360878 predicted 280
3 SASI_Rn02_00360879 predicted 513
4 SASI_Rn02_00360880 predicted 1194
5 SASI_Rn02_00360881 predicted 1638
6 SASI_Rn02_00360882 predicted 1218
7 SASI_Rn02_00360883 predicted 1153
8 SASI_Rn02_00360884 predicted 348
9 SASI_Rn02_00360885 predicted 1363
10 SASI_Rn02_00360886 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034461 predicted 1638
2 SASI_Mm01_00034462 predicted 1189
3 SASI_Mm01_00034463 predicted 494
4 SASI_Mm01_00034464 predicted 522
5 SASI_Mm01_00034465 predicted 199
6 SASI_Mm01_00034466 predicted 207
7 SASI_Mm01_00034467 predicted 513
8 SASI_Mm01_00034468 predicted 1121
9 SASI_Mm01_00034469 predicted 895
10 SASI_Mm02_00317508 predicted 1215
11 SASI_Mm01_00034470 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009947
CPNE6 MISSION shRNA Bacterial Glycerol Stock
copine VI (neuronal)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009947.2-1831s1c1
Sequence:CCGGGTGACCTGTGTCTCTGCATTTCTCGAGAAATGCAGAGACACAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-756s1c1
Sequence:CCGGCCGCTCAAGTTCCTGGTATATCTCGAGATATACCAGGAACTTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-541s1c1
Sequence:CCGGCCAACGACTATGTGCAACTTACTCGAGTAAGTTGCACATAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-540s1c1
Sequence:CCGGACCAACGACTATGTGCAACTTCTCGAGAAGTTGCACATAGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-1221s1c1
Sequence:CCGGGCTATCAACTTTGACCCAGAACTCGAGTTCTGGGTCAAAGTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-567s21c1
Sequence:CCGGAGAGCCCACAAGCTGGATAACCTCGAGGTTATCCAGCTTGTGGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-1418s21c1
Sequence:CCGGTGACGGTGTGGTGAGTGATATCTCGAGATATCACTCACCACACCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-969s21c1
Sequence:CCGGCACACCTTCCTGGATTATATCCTCGAGGATATAATCCAGGAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-1762s21c1
Sequence:CCGGCATGACTGCCTCTCGACATAACTCGAGTTATGTCGAGAGGCAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009947
CPNE6 MISSION shRNA shRNA Plasmid DNA
copine VI (neuronal)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009947.2-1831s1c1
Sequence:CCGGGTGACCTGTGTCTCTGCATTTCTCGAGAAATGCAGAGACACAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-756s1c1
Sequence:CCGGCCGCTCAAGTTCCTGGTATATCTCGAGATATACCAGGAACTTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-541s1c1
Sequence:CCGGCCAACGACTATGTGCAACTTACTCGAGTAAGTTGCACATAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-540s1c1
Sequence:CCGGACCAACGACTATGTGCAACTTCTCGAGAAGTTGCACATAGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-1221s1c1
Sequence:CCGGGCTATCAACTTTGACCCAGAACTCGAGTTCTGGGTCAAAGTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-567s21c1
Sequence:CCGGAGAGCCCACAAGCTGGATAACCTCGAGGTTATCCAGCTTGTGGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-1418s21c1
Sequence:CCGGTGACGGTGTGGTGAGTGATATCTCGAGATATCACTCACCACACCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-969s21c1
Sequence:CCGGCACACCTTCCTGGATTATATCCTCGAGGATATAATCCAGGAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-1762s21c1
Sequence:CCGGCATGACTGCCTCTCGACATAACTCGAGTTATGTCGAGAGGCAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009947
CPNE6 MISSION shRNA Lentiviral Transduction Particles
copine VI (neuronal)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009947.2-1831s1c1
Sequence:CCGGGTGACCTGTGTCTCTGCATTTCTCGAGAAATGCAGAGACACAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-756s1c1
Sequence:CCGGCCGCTCAAGTTCCTGGTATATCTCGAGATATACCAGGAACTTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-541s1c1
Sequence:CCGGCCAACGACTATGTGCAACTTACTCGAGTAAGTTGCACATAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-540s1c1
Sequence:CCGGACCAACGACTATGTGCAACTTCTCGAGAAGTTGCACATAGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009947.2-1221s1c1
Sequence:CCGGGCTATCAACTTTGACCCAGAACTCGAGTTCTGGGTCAAAGTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-567s21c1
Sequence:CCGGAGAGCCCACAAGCTGGATAACCTCGAGGTTATCCAGCTTGTGGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-1418s21c1
Sequence:CCGGTGACGGTGTGGTGAGTGATATCTCGAGATATCACTCACCACACCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-969s21c1
Sequence:CCGGCACACCTTCCTGGATTATATCCTCGAGGATATAATCCAGGAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009947.3-1762s21c1
Sequence:CCGGCATGACTGCCTCTCGACATAACTCGAGTTATGTCGAGAGGCAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006032
CPNE6 MISSION shRNA Bacterial Glycerol Stock
copine VI (neuronal)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-440s1c1
Sequence:CCGGTGGGCCAGATTGTGTCACAAACTCGAGTTTGTGACACAATCTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-1228s1c1
Sequence:CCGGGCTATCAACTTTGACCCGGAACTCGAGTTCCGGGTCAAAGTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-462s1c1
Sequence:CCGGCAAGGTCACTAAGCCATTATTCTCGAGAATAATGGCTTAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-618s1c1
Sequence:CCGGCCCTTTCATGGAAATCTATAACTCGAGTTATAGATTTCCATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-975s1c1
Sequence:CCGGGCACACCTTCCTGGATTACATCTCGAGATGTAATCCAGGAAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-539s21c1
Sequence:CCGGTATCAGGCACAAACGACTATGCTCGAGCATAGTCGTTTGTGCCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-737s21c1
Sequence:CCGGCCCTATGCAGCTGTGATGTTCCTCGAGGAACATCACAGCTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-642s21c1
Sequence:CCGGCAACGAGGACCAAAGTGATCACTCGAGTGATCACTTTGGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006032
CPNE6 MISSION shRNA shRNA Plasmid DNA
copine VI (neuronal)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-440s1c1
Sequence:CCGGTGGGCCAGATTGTGTCACAAACTCGAGTTTGTGACACAATCTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-1228s1c1
Sequence:CCGGGCTATCAACTTTGACCCGGAACTCGAGTTCCGGGTCAAAGTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-462s1c1
Sequence:CCGGCAAGGTCACTAAGCCATTATTCTCGAGAATAATGGCTTAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-618s1c1
Sequence:CCGGCCCTTTCATGGAAATCTATAACTCGAGTTATAGATTTCCATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-975s1c1
Sequence:CCGGGCACACCTTCCTGGATTACATCTCGAGATGTAATCCAGGAAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-539s21c1
Sequence:CCGGTATCAGGCACAAACGACTATGCTCGAGCATAGTCGTTTGTGCCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-737s21c1
Sequence:CCGGCCCTATGCAGCTGTGATGTTCCTCGAGGAACATCACAGCTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-642s21c1
Sequence:CCGGCAACGAGGACCAAAGTGATCACTCGAGTGATCACTTTGGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006032
CPNE6 MISSION shRNA Lentiviral Transduction Particles
copine VI (neuronal)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-440s1c1
Sequence:CCGGTGGGCCAGATTGTGTCACAAACTCGAGTTTGTGACACAATCTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-1228s1c1
Sequence:CCGGGCTATCAACTTTGACCCGGAACTCGAGTTCCGGGTCAAAGTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-462s1c1
Sequence:CCGGCAAGGTCACTAAGCCATTATTCTCGAGAATAATGGCTTAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-618s1c1
Sequence:CCGGCCCTTTCATGGAAATCTATAACTCGAGTTATAGATTTCCATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006032.2-975s1c1
Sequence:CCGGGCACACCTTCCTGGATTACATCTCGAGATGTAATCCAGGAAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-539s21c1
Sequence:CCGGTATCAGGCACAAACGACTATGCTCGAGCATAGTCGTTTGTGCCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-737s21c1
Sequence:CCGGCCCTATGCAGCTGTGATGTTCCTCGAGGAACATCACAGCTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006032.2-642s21c1
Sequence:CCGGCAACGAGGACCAAAGTGATCACTCGAGTGATCACTTTGGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks