EMAIL THIS PAGE TO A FRIEND

CPNE7

copine VII

57 Gene Product Result for
UniProtKB ID: Q9UBL6
Gene ID:
Human(27132) Summary: This gene encodes a member of the copine family, which is composed of calcium-dependent membrane-binding proteins. The gene product contains two N-terminal C2 domains and one von Willebrand factor A domain. The encoded protein may be involved in membrane trafficking. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Mouse(102278) copine VII
Rat(361433) copine VII
chicken(415851) copine VII
cow(515424) copine VII
Horse(100052136) copine VII
dog(608773) copine VII
sheep(101110962) copine VII
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014427 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014427 Rosetta Predictions human pricing
NM_153636 Rosetta Predictions human pricing
NM_001108454 Rosetta Predictions rat pricing
NM_170684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013311 predicted 2272
2 SASI_Hs01_00013312 predicted 2067
3 SASI_Hs01_00013313 predicted 2070
4 SASI_Hs01_00013314 predicted 1501
5 SASI_Hs01_00013315 predicted 1231
6 SASI_Hs01_00013316 predicted 1019
7 SASI_Hs01_00013317 predicted 1045
8 SASI_Hs01_00013318 predicted 1226
9 SASI_Hs01_00013319 predicted 1388
10 SASI_Hs01_00013320 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114616 predicted 2047
2 SASI_Hs01_00114617 predicted 1839
3 SASI_Hs01_00114618 predicted 1844
4 SASI_Hs01_00114619 predicted 1279
5 SASI_Hs01_00114620 predicted 1000
6 SASI_Hs01_00114621 predicted 802
7 SASI_Hs01_00114622 predicted 814
8 SASI_Hs01_00114623 predicted 999
9 SASI_Hs01_00114624 predicted 1164
10 SASI_Hs01_00114625 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238799 predicted 767
2 SASI_Rn02_00238800 predicted 460
3 SASI_Rn02_00238801 predicted 1735
4 SASI_Rn02_00238802 predicted 376
5 SASI_Rn02_00238803 predicted 648
6 SASI_Rn02_00238804 predicted 1478
7 SASI_Rn02_00238805 predicted 1240
8 SASI_Rn02_00238806 predicted 1600
9 SASI_Rn02_00238807 predicted 1329
10 SASI_Rn02_00238808 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055776 predicted 1855
2 SASI_Mm01_00055777 predicted 931
3 SASI_Mm01_00055779 predicted 1420
4 SASI_Mm01_00055780 predicted 456
5 SASI_Mm02_00343565 predicted 808
6 SASI_Mm01_00055781 predicted 1539
7 SASI_Mm01_00055782 predicted 1245
8 SASI_Mm01_00055783 predicted 1222
9 SASI_Mm01_00055784 predicted 706
10 SASI_Mm01_00055785 predicted 1457
11 SASI_Mm01_00055778 predicted 1258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014427
CPNE7 MISSION shRNA Bacterial Glycerol Stock
copine VII
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-437s21c1
Sequence:CCGGAGCTGTCAGGAGGACGATTTCCTCGAGGAAATCGTCCTCCTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-1060s21c1
Sequence:CCGGTCGAGGAAAGCACGACTTCATCTCGAGATGAAGTCGTGCTTTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-1642s21c1
Sequence:CCGGCACCGGGAAAGCCTCTCAATACTCGAGTATTGAGAGGCTTTCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-358s1c1
Sequence:CCGGCTTCACGGTGGACTACTACTTCTCGAGAAGTAGTAGTCCACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-512s1c1
Sequence:CCGGGTCGTGATGAGAGTGTCTGTTCTCGAGAACAGACACTCTCATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1168s1c1
Sequence:CCGGGCAGAAGAGACGCAGTTATAACTCGAGTTATAACTGCGTCTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1477s1c1
Sequence:CCGGCCATGACTTTGCCATCAATTTCTCGAGAAATTGATGGCAAAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1157s1c1
Sequence:CCGGCCCAAATACAAGCAGAAGAGACTCGAGTCTCTTCTGCTTGTATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-503s1c1
Sequence:CCGGCTTCTGCAAGTCGTGATGAGACTCGAGTCTCATCACGACTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-980s1c1
Sequence:CCGGGCCTTCAAAGTCTCTCTGAGTCTCGAGACTCAGAGAGACTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014427
CPNE7 MISSION shRNA shRNA Plasmid DNA
copine VII
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-437s21c1
Sequence:CCGGAGCTGTCAGGAGGACGATTTCCTCGAGGAAATCGTCCTCCTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-1060s21c1
Sequence:CCGGTCGAGGAAAGCACGACTTCATCTCGAGATGAAGTCGTGCTTTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-1642s21c1
Sequence:CCGGCACCGGGAAAGCCTCTCAATACTCGAGTATTGAGAGGCTTTCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-358s1c1
Sequence:CCGGCTTCACGGTGGACTACTACTTCTCGAGAAGTAGTAGTCCACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-512s1c1
Sequence:CCGGGTCGTGATGAGAGTGTCTGTTCTCGAGAACAGACACTCTCATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1168s1c1
Sequence:CCGGGCAGAAGAGACGCAGTTATAACTCGAGTTATAACTGCGTCTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1477s1c1
Sequence:CCGGCCATGACTTTGCCATCAATTTCTCGAGAAATTGATGGCAAAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1157s1c1
Sequence:CCGGCCCAAATACAAGCAGAAGAGACTCGAGTCTCTTCTGCTTGTATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-503s1c1
Sequence:CCGGCTTCTGCAAGTCGTGATGAGACTCGAGTCTCATCACGACTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-980s1c1
Sequence:CCGGGCCTTCAAAGTCTCTCTGAGTCTCGAGACTCAGAGAGACTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014427
CPNE7 MISSION shRNA Lentiviral Transduction Particles
copine VII
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-437s21c1
Sequence:CCGGAGCTGTCAGGAGGACGATTTCCTCGAGGAAATCGTCCTCCTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-1060s21c1
Sequence:CCGGTCGAGGAAAGCACGACTTCATCTCGAGATGAAGTCGTGCTTTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014427.4-1642s21c1
Sequence:CCGGCACCGGGAAAGCCTCTCAATACTCGAGTATTGAGAGGCTTTCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-358s1c1
Sequence:CCGGCTTCACGGTGGACTACTACTTCTCGAGAAGTAGTAGTCCACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-512s1c1
Sequence:CCGGGTCGTGATGAGAGTGTCTGTTCTCGAGAACAGACACTCTCATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1168s1c1
Sequence:CCGGGCAGAAGAGACGCAGTTATAACTCGAGTTATAACTGCGTCTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1477s1c1
Sequence:CCGGCCATGACTTTGCCATCAATTTCTCGAGAAATTGATGGCAAAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-1157s1c1
Sequence:CCGGCCCAAATACAAGCAGAAGAGACTCGAGTCTCTTCTGCTTGTATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-503s1c1
Sequence:CCGGCTTCTGCAAGTCGTGATGAGACTCGAGTCTCATCACGACTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014427.3-980s1c1
Sequence:CCGGGCCTTCAAAGTCTCTCTGAGTCTCGAGACTCAGAGAGACTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170684
CPNE7 MISSION shRNA Bacterial Glycerol Stock
copine VII
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170684.2-1000s21c1
Sequence:CCGGCACTCCTTCCTGGATTACATCCTCGAGGATGTAATCCAGGAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170684.2-509s21c1
Sequence:CCGGTGTTGCGATTCGGCAGGAATGCTCGAGCATTCCTGCCGAATCGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170684.1-1942s1c1
Sequence:CCGGGCAGGGTGTTCTGAAAGAAATCTCGAGATTTCTTTCAGAACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-844s1c1
Sequence:CCGGGTACAAACAGAAGAAGCGCAACTCGAGTTGCGCTTCTTCTGTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-847s1c1
Sequence:CCGGCAAACAGAAGAAGCGCAATTACTCGAGTAATTGCGCTTCTTCTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-568s1c1
Sequence:CCGGCCTAGAGCTGTATCGGGTTAACTCGAGTTAACCCGATACAGCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-1158s1c1
Sequence:CCGGCCCACGACTTTGCCATCAATTCTCGAGAATTGATGGCAAAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170684
CPNE7 MISSION shRNA shRNA Plasmid DNA
copine VII
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170684.2-1000s21c1
Sequence:CCGGCACTCCTTCCTGGATTACATCCTCGAGGATGTAATCCAGGAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170684.2-509s21c1
Sequence:CCGGTGTTGCGATTCGGCAGGAATGCTCGAGCATTCCTGCCGAATCGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170684.1-1942s1c1
Sequence:CCGGGCAGGGTGTTCTGAAAGAAATCTCGAGATTTCTTTCAGAACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-844s1c1
Sequence:CCGGGTACAAACAGAAGAAGCGCAACTCGAGTTGCGCTTCTTCTGTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-847s1c1
Sequence:CCGGCAAACAGAAGAAGCGCAATTACTCGAGTAATTGCGCTTCTTCTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-568s1c1
Sequence:CCGGCCTAGAGCTGTATCGGGTTAACTCGAGTTAACCCGATACAGCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-1158s1c1
Sequence:CCGGCCCACGACTTTGCCATCAATTCTCGAGAATTGATGGCAAAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170684
CPNE7 MISSION shRNA Lentiviral Transduction Particles
copine VII
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170684.2-1000s21c1
Sequence:CCGGCACTCCTTCCTGGATTACATCCTCGAGGATGTAATCCAGGAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170684.2-509s21c1
Sequence:CCGGTGTTGCGATTCGGCAGGAATGCTCGAGCATTCCTGCCGAATCGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170684.1-1942s1c1
Sequence:CCGGGCAGGGTGTTCTGAAAGAAATCTCGAGATTTCTTTCAGAACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-844s1c1
Sequence:CCGGGTACAAACAGAAGAAGCGCAACTCGAGTTGCGCTTCTTCTGTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-847s1c1
Sequence:CCGGCAAACAGAAGAAGCGCAATTACTCGAGTAATTGCGCTTCTTCTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-568s1c1
Sequence:CCGGCCTAGAGCTGTATCGGGTTAACTCGAGTTAACCCGATACAGCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170684.1-1158s1c1
Sequence:CCGGCCCACGACTTTGCCATCAATTCTCGAGAATTGATGGCAAAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks