EMAIL THIS PAGE TO A FRIEND

CPNE8

copine VIII

152 Gene Product Result for
UniProtKB ID: Q86YQ8, Q2TB41
Gene ID:
Human(144402) Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encode a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Mouse(66871) copine VIII
Rat(362988) copine VIII
sheep(101120909) copine VIII
Zebrafish(100332028) copine VIII
cow(535744) copine VIII
Horse(100064982) copine VIII
dog(477646) copine VIII
chicken(417690) copine VIII
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153634 Rosetta Predictions human pricing
NM_001108750 Rosetta Predictions rat pricing
NM_001033851 Rosetta Predictions mouse pricing
NM_025815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223294 predicted 399
2 SASI_Hs01_00223295 predicted 1319
3 SASI_Hs01_00223296 predicted 1442
4 SASI_Hs01_00223297 predicted 1435
5 SASI_Hs01_00223298 predicted 1778
6 SASI_Hs01_00223299 predicted 279
7 SASI_Hs02_00367374 predicted 521
8 SASI_Hs02_00367375 predicted 266
9 SASI_Hs01_00223300 predicted 1625
10 SASI_Hs02_00367376 predicted 1751
11 SASI_Hs01_00223293 predicted 509
12 SASI_Hs01_00223301 predicted 1128
13 SASI_Hs01_00223302 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241715 predicted 402
2 SASI_Rn02_00241716 predicted 1000
3 SASI_Rn02_00241717 predicted 1148
4 SASI_Rn02_00241718 predicted 586
5 SASI_Rn02_00241719 predicted 1165
6 SASI_Rn02_00241720 predicted 1550
7 SASI_Rn02_00241721 predicted 1673
8 SASI_Rn02_00241722 predicted 1435
9 SASI_Rn02_00241723 predicted 1298
10 SASI_Rn02_00241724 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027803 predicted 252
2 SASI_Mm01_00027804 predicted 212
3 SASI_Mm01_00027805 predicted 320
4 SASI_Mm01_00027806 predicted 220
5 SASI_Mm01_00027807 predicted 219
6 SASI_Mm02_00289013 predicted 253
7 SASI_Mm01_00027808 predicted 255
8 SASI_Mm01_00027809 predicted 357
9 SASI_Mm01_00027810 predicted 340
10 SASI_Mm01_00027812 predicted 270
11 SASI_Mm01_00027811 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024126 predicted 401
2 SASI_Mm02_00329064 predicted 1584
3 SASI_Mm01_00024127 predicted 1492
4 SASI_Mm01_00024128 predicted 214
5 SASI_Mm01_00024130 predicted 1421
6 SASI_Mm01_00024131 predicted 1470
7 SASI_Mm01_00024132 predicted 1451
8 SASI_Mm01_00024133 predicted 554
9 SASI_Mm01_00024134 predicted 1628
10 SASI_Mm01_00024135 predicted 645
11 SASI_Mm01_00024129 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153634
VALIDATED
CPNE8 MISSION shRNA Bacterial Glycerol Stock
copine VIII
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-1222s1c1
Sequence:CCGGGCTTTGAATGGGAATCCTCAACTCGAGTTGAGGATTCCCATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-1632s1c1
Sequence:CCGGCATACTGAGCATGGCTAGATTCTCGAGAATCTAGCCATGCTCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153634.2-1845s1c1
Sequence:CCGGGCTCTGTAATGAACCAGGCAACTCGAGTTGCCTGGTTCATTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-500s1c1
Sequence:CCGGCAGGGAAGAAATGTGGTACAACTCGAGTTGTACCACATTTCTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-1638s1c1
Sequence:CCGGGAGCATGGCTAGATTGGCTAACTCGAGTTAGCCAATCTAGCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153634.2-1089s1c1
Sequence:CCGGCCAACTGAATGCCTATGGTATCTCGAGATACCATAGGCATTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153634.2-858s1c1
Sequence:CCGGGCAGTCACAATTCAACGTATACTCGAGTATACGTTGAATTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-1573s1c1
Sequence:CCGGGAAAGAGACATTGTGCAGTTTCTCGAGAAACTGCACAATGTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-2872s1c1
Sequence:CCGGCCTGTCCACGAATAATTGTAACTCGAGTTACAATTATTCGTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1322s21c1
Sequence:CCGGCCAACTTTGCTCCTGTAATTACTCGAGTAATTACAGGAGCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-987s21c1
Sequence:CCGGCATTAAGGGAGGGACGCAAATCTCGAGATTTGCGTCCCTCCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1437s21c1
Sequence:CCGGGACTAAGGAGTCCATAGTTAACTCGAGTTAACTATGGACTCCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1510s21c1
Sequence:CCGGTTTGATGCAATGGTCGAATTGCTCGAGCAATTCGACCATTGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153634.2-2004s21c1
Sequence:CCGGTATGGATGTCTTCTCTAAATCCTCGAGGATTTAGAGAAGACATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153634.2-2042s21c1
Sequence:CCGGTTAACAGAAACAGCTAATTTCCTCGAGGAAATTAGCTGTTTCTGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-217s21c1
Sequence:CCGGGATCCAATTTGTGTCTTATATCTCGAGATATAAGACACAAATTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153634
VALIDATED
CPNE8 MISSION shRNA shRNA Plasmid DNA
copine VIII
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-1222s1c1
Sequence:CCGGGCTTTGAATGGGAATCCTCAACTCGAGTTGAGGATTCCCATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-1632s1c1
Sequence:CCGGCATACTGAGCATGGCTAGATTCTCGAGAATCTAGCCATGCTCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153634.2-1845s1c1
Sequence:CCGGGCTCTGTAATGAACCAGGCAACTCGAGTTGCCTGGTTCATTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-500s1c1
Sequence:CCGGCAGGGAAGAAATGTGGTACAACTCGAGTTGTACCACATTTCTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-1638s1c1
Sequence:CCGGGAGCATGGCTAGATTGGCTAACTCGAGTTAGCCAATCTAGCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153634.2-1089s1c1
Sequence:CCGGCCAACTGAATGCCTATGGTATCTCGAGATACCATAGGCATTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153634.2-858s1c1
Sequence:CCGGGCAGTCACAATTCAACGTATACTCGAGTATACGTTGAATTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-1573s1c1
Sequence:CCGGGAAAGAGACATTGTGCAGTTTCTCGAGAAACTGCACAATGTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-2872s1c1
Sequence:CCGGCCTGTCCACGAATAATTGTAACTCGAGTTACAATTATTCGTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1322s21c1
Sequence:CCGGCCAACTTTGCTCCTGTAATTACTCGAGTAATTACAGGAGCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-987s21c1
Sequence:CCGGCATTAAGGGAGGGACGCAAATCTCGAGATTTGCGTCCCTCCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1437s21c1
Sequence:CCGGGACTAAGGAGTCCATAGTTAACTCGAGTTAACTATGGACTCCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1510s21c1
Sequence:CCGGTTTGATGCAATGGTCGAATTGCTCGAGCAATTCGACCATTGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153634.2-2004s21c1
Sequence:CCGGTATGGATGTCTTCTCTAAATCCTCGAGGATTTAGAGAAGACATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153634.2-2042s21c1
Sequence:CCGGTTAACAGAAACAGCTAATTTCCTCGAGGAAATTAGCTGTTTCTGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-217s21c1
Sequence:CCGGGATCCAATTTGTGTCTTATATCTCGAGATATAAGACACAAATTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153634
VALIDATED
CPNE8 MISSION shRNA Lentiviral Transduction Particles
copine VIII
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-1222s1c1
Sequence:CCGGGCTTTGAATGGGAATCCTCAACTCGAGTTGAGGATTCCCATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-1632s1c1
Sequence:CCGGCATACTGAGCATGGCTAGATTCTCGAGAATCTAGCCATGCTCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153634.2-1845s1c1
Sequence:CCGGGCTCTGTAATGAACCAGGCAACTCGAGTTGCCTGGTTCATTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-500s1c1
Sequence:CCGGCAGGGAAGAAATGTGGTACAACTCGAGTTGTACCACATTTCTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153634.2-1638s1c1
Sequence:CCGGGAGCATGGCTAGATTGGCTAACTCGAGTTAGCCAATCTAGCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153634.2-1089s1c1
Sequence:CCGGCCAACTGAATGCCTATGGTATCTCGAGATACCATAGGCATTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153634.2-858s1c1
Sequence:CCGGGCAGTCACAATTCAACGTATACTCGAGTATACGTTGAATTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-1573s1c1
Sequence:CCGGGAAAGAGACATTGTGCAGTTTCTCGAGAAACTGCACAATGTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153634.2-2872s1c1
Sequence:CCGGCCTGTCCACGAATAATTGTAACTCGAGTTACAATTATTCGTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1322s21c1
Sequence:CCGGCCAACTTTGCTCCTGTAATTACTCGAGTAATTACAGGAGCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-987s21c1
Sequence:CCGGCATTAAGGGAGGGACGCAAATCTCGAGATTTGCGTCCCTCCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1437s21c1
Sequence:CCGGGACTAAGGAGTCCATAGTTAACTCGAGTTAACTATGGACTCCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-1510s21c1
Sequence:CCGGTTTGATGCAATGGTCGAATTGCTCGAGCAATTCGACCATTGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153634.2-2004s21c1
Sequence:CCGGTATGGATGTCTTCTCTAAATCCTCGAGGATTTAGAGAAGACATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153634.2-2042s21c1
Sequence:CCGGTTAACAGAAACAGCTAATTTCCTCGAGGAAATTAGCTGTTTCTGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153634.2-217s21c1
Sequence:CCGGGATCCAATTTGTGTCTTATATCTCGAGATATAAGACACAAATTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025815
VALIDATED
CPNE8 MISSION shRNA Bacterial Glycerol Stock
copine VIII
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-317s21c1
Sequence:CCGGGAACTGAAGTGATCGATAATACTCGAGTATTATCGATCACTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025815.1-242s1c1
Sequence:CCGGCGGATCCAATTTGTGTCCTATCTCGAGATAGGACACAAATTGGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-2405s1c1
Sequence:CCGGCCGTGGGAGTTTCAACTTATACTCGAGTATAAGTTGAAACTCCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025815.1-1494s1c1
Sequence:CCGGGCTTCCCATGTCAATAATAATCTCGAGATTATTATTGACATGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-885s1c1
Sequence:CCGGGCAGTCACAATTCAACGTCTACTCGAGTAGACGTTGAATTGTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-1357s1c1
Sequence:CCGGGCTCCCGTAATAAACCACGTACTCGAGTACGTGGTTTATTACGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025815.2-2192s21c1
Sequence:CCGGCAGTCTCTGTGTCGATGTTTACTCGAGTAAACATCGACACAGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-1796s21c1
Sequence:CCGGACGTGCTGCAGACGCAAATATCTCGAGATATTTGCGTCTGCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-1307s21c1
Sequence:CCGGGTGTCATGGAAGCTTACTATACTCGAGTATAGTAAGCTTCCATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025815
VALIDATED
CPNE8 MISSION shRNA shRNA Plasmid DNA
copine VIII
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-317s21c1
Sequence:CCGGGAACTGAAGTGATCGATAATACTCGAGTATTATCGATCACTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025815.1-242s1c1
Sequence:CCGGCGGATCCAATTTGTGTCCTATCTCGAGATAGGACACAAATTGGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-2405s1c1
Sequence:CCGGCCGTGGGAGTTTCAACTTATACTCGAGTATAAGTTGAAACTCCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025815.1-1494s1c1
Sequence:CCGGGCTTCCCATGTCAATAATAATCTCGAGATTATTATTGACATGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-885s1c1
Sequence:CCGGGCAGTCACAATTCAACGTCTACTCGAGTAGACGTTGAATTGTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-1357s1c1
Sequence:CCGGGCTCCCGTAATAAACCACGTACTCGAGTACGTGGTTTATTACGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025815.2-2192s21c1
Sequence:CCGGCAGTCTCTGTGTCGATGTTTACTCGAGTAAACATCGACACAGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-1796s21c1
Sequence:CCGGACGTGCTGCAGACGCAAATATCTCGAGATATTTGCGTCTGCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-1307s21c1
Sequence:CCGGGTGTCATGGAAGCTTACTATACTCGAGTATAGTAAGCTTCCATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025815
VALIDATED
CPNE8 MISSION shRNA Lentiviral Transduction Particles
copine VIII
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-317s21c1
Sequence:CCGGGAACTGAAGTGATCGATAATACTCGAGTATTATCGATCACTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025815.1-242s1c1
Sequence:CCGGCGGATCCAATTTGTGTCCTATCTCGAGATAGGACACAAATTGGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-2405s1c1
Sequence:CCGGCCGTGGGAGTTTCAACTTATACTCGAGTATAAGTTGAAACTCCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025815.1-1494s1c1
Sequence:CCGGGCTTCCCATGTCAATAATAATCTCGAGATTATTATTGACATGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-885s1c1
Sequence:CCGGGCAGTCACAATTCAACGTCTACTCGAGTAGACGTTGAATTGTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025815.1-1357s1c1
Sequence:CCGGGCTCCCGTAATAAACCACGTACTCGAGTACGTGGTTTATTACGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025815.2-2192s21c1
Sequence:CCGGCAGTCTCTGTGTCGATGTTTACTCGAGTAAACATCGACACAGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-1796s21c1
Sequence:CCGGACGTGCTGCAGACGCAAATATCTCGAGATATTTGCGTCTGCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025815.2-1307s21c1
Sequence:CCGGGTGTCATGGAAGCTTACTATACTCGAGTATAGTAAGCTTCCATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks