EMAIL THIS PAGE TO A FRIEND

CPNE9

copine family member IX

58 Gene Product Result for
UniProtKB ID: Q8IYJ1, A1L430, A6NDX6, A8MSP8
Gene ID:
Mouse(211232) copine family member IX
Rat(297516) copine family member IX
Zebrafish(100333848) copine family member IX
cow(785580) copine family member IX
Horse(100058488) copine family member IX
domestic cat(101090846) copine family member IX
dog(610186) copine family member IX
chicken(101747832) copine family member IX
chicken(101668551) copine family member IX
naked mole-rat(101725443) copine family member IX
domestic guinea pig(100719941) copine family member IX
sheep(101104863) copine family member IX
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153635 Rosetta Predictions human pricing
NM_001024982 Rosetta Predictions rat pricing
NM_170673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241651 predicted 926
2 SASI_Hs01_00241652 predicted 801
3 SASI_Hs01_00241654 predicted 937
4 SASI_Hs01_00241655 predicted 372
5 SASI_Hs01_00241656 predicted 1209
6 SASI_Hs02_00367377 predicted 1744
7 SASI_Hs01_00241657 predicted 358
8 SASI_Hs01_00241658 predicted 571
9 SASI_Hs01_00241659 predicted 597
10 SASI_Hs01_00241660 predicted 847
11 SASI_Hs01_00241653 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202856 predicted 299
2 SASI_Rn01_00106631 predicted 1094
3 SASI_Rn02_00202857 predicted 296
4 SASI_Rn01_00106632 predicted 744
5 SASI_Rn01_00106633 predicted 1351
6 SASI_Rn01_00106634 predicted 1473
7 SASI_Rn01_00106637 predicted 638
8 SASI_Rn01_00106638 predicted 850
9 SASI_Rn01_00106639 predicted 363
10 SASI_Rn02_00202858 predicted 785
11 SASI_Rn01_00106635 predicted 1732
12 SASI_Rn01_00106636 predicted 670
13 SASI_Rn01_00106640 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174200 predicted 800
2 SASI_Mm01_00174201 predicted 921
3 SASI_Mm01_00174202 predicted 352
4 SASI_Mm01_00174203 predicted 333
5 SASI_Mm01_00174204 predicted 928
6 SASI_Mm01_00174205 predicted 1557
7 SASI_Mm01_00174206 predicted 446
8 SASI_Mm01_00174207 predicted 200
9 SASI_Mm01_00174208 predicted 1367
10 SASI_Mm01_00174209 predicted 1359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175079
CPNE9 MISSION shRNA Bacterial Glycerol Stock
copine family member IX
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175079.1-1929s1c1
Sequence:CCGGCCAATGCTTAGCAGTCTGCTTCTCGAGAAGCAGACTGCTAAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-1030s1c1
Sequence:CCGGCCCTCGGAAGAAATGCAAGAACTCGAGTTCTTGCATTTCTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-459s1c1
Sequence:CCGGGCAAATTCGTTCTCGACTATTCTCGAGAATAGTCGAGAACGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-458s1c1
Sequence:CCGGCGCAAATTCGTTCTCGACTATCTCGAGATAGTCGAGAACGAATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-766s1c1
Sequence:CCGGCCTTGTGTTCTACAGGAGCAACTCGAGTTGCTCCTGTAGAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175079
CPNE9 MISSION shRNA shRNA Plasmid DNA
copine family member IX
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175079.1-1929s1c1
Sequence:CCGGCCAATGCTTAGCAGTCTGCTTCTCGAGAAGCAGACTGCTAAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-1030s1c1
Sequence:CCGGCCCTCGGAAGAAATGCAAGAACTCGAGTTCTTGCATTTCTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-459s1c1
Sequence:CCGGGCAAATTCGTTCTCGACTATTCTCGAGAATAGTCGAGAACGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-458s1c1
Sequence:CCGGCGCAAATTCGTTCTCGACTATCTCGAGATAGTCGAGAACGAATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-766s1c1
Sequence:CCGGCCTTGTGTTCTACAGGAGCAACTCGAGTTGCTCCTGTAGAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175079
CPNE9 MISSION shRNA Lentiviral Transduction Particles
copine family member IX
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175079.1-1929s1c1
Sequence:CCGGCCAATGCTTAGCAGTCTGCTTCTCGAGAAGCAGACTGCTAAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-1030s1c1
Sequence:CCGGCCCTCGGAAGAAATGCAAGAACTCGAGTTCTTGCATTTCTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-459s1c1
Sequence:CCGGGCAAATTCGTTCTCGACTATTCTCGAGAATAGTCGAGAACGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-458s1c1
Sequence:CCGGCGCAAATTCGTTCTCGACTATCTCGAGATAGTCGAGAACGAATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175079.1-766s1c1
Sequence:CCGGCCTTGTGTTCTACAGGAGCAACTCGAGTTGCTCCTGTAGAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153635
CPNE9 MISSION shRNA Bacterial Glycerol Stock
copine family member IX
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1059s1c1
Sequence:CCGGGCTGAACTTCACAGTAGCCATCTCGAGATGGCTACTGTGAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-558s1c1
Sequence:CCGGCAAGAAGTGTGGGACCATATTCTCGAGAATATGGTCCCACACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-924s1c1
Sequence:CCGGCACAGTATATGAGGTTCTTAACTCGAGTTAAGAACCTCATATACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1060s1c1
Sequence:CCGGCTGAACTTCACAGTAGCCATTCTCGAGAATGGCTACTGTGAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-912s1c1
Sequence:CCGGCCAGAACCAGTTCACAGTATACTCGAGTATACTGTGAACTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1635s1c1
Sequence:CCGGCATCGTTCAGTTCGTCCCATTCTCGAGAATGGGACGAACTGAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153635
CPNE9 MISSION shRNA shRNA Plasmid DNA
copine family member IX
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1059s1c1
Sequence:CCGGGCTGAACTTCACAGTAGCCATCTCGAGATGGCTACTGTGAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-558s1c1
Sequence:CCGGCAAGAAGTGTGGGACCATATTCTCGAGAATATGGTCCCACACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-924s1c1
Sequence:CCGGCACAGTATATGAGGTTCTTAACTCGAGTTAAGAACCTCATATACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1060s1c1
Sequence:CCGGCTGAACTTCACAGTAGCCATTCTCGAGAATGGCTACTGTGAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-912s1c1
Sequence:CCGGCCAGAACCAGTTCACAGTATACTCGAGTATACTGTGAACTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1635s1c1
Sequence:CCGGCATCGTTCAGTTCGTCCCATTCTCGAGAATGGGACGAACTGAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153635
CPNE9 MISSION shRNA Lentiviral Transduction Particles
copine family member IX
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1059s1c1
Sequence:CCGGGCTGAACTTCACAGTAGCCATCTCGAGATGGCTACTGTGAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-558s1c1
Sequence:CCGGCAAGAAGTGTGGGACCATATTCTCGAGAATATGGTCCCACACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-924s1c1
Sequence:CCGGCACAGTATATGAGGTTCTTAACTCGAGTTAAGAACCTCATATACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1060s1c1
Sequence:CCGGCTGAACTTCACAGTAGCCATTCTCGAGAATGGCTACTGTGAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-912s1c1
Sequence:CCGGCCAGAACCAGTTCACAGTATACTCGAGTATACTGTGAACTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153635.1-1635s1c1
Sequence:CCGGCATCGTTCAGTTCGTCCCATTCTCGAGAATGGGACGAACTGAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks