EMAIL THIS PAGE TO A FRIEND

CPO

carboxypeptidase O

21 Gene Product Result for
UniProtKB ID: Q8IVL8, Q2M277, Q7RTW7
Gene ID:
Human(130749) Summary: This gene is a member of the metallocarboxypeptidase gene family. [provided by RefSeq, Jan 2011]
Zebrafish(100319803) carboxypeptidase O
chicken(424095) carboxypeptidase O
cow(508767) carboxypeptidase O
domestic cat(101097267) carboxypeptidase O
dog(609702) carboxypeptidase O
fruit fly(45840) couch potato
sheep(101117140) carboxypeptidase O
domestic guinea pig(100718880) carboxypeptidase O
naked mole-rat(101696391) carboxypeptidase O
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173077 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151071 MISSION® esiRNA esiRNA human CPO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173077 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146426 predicted 330
2 SASI_Hs01_00146427 predicted 437
3 SASI_Hs01_00146428 predicted 808
4 SASI_Hs02_00368068 predicted 755
5 SASI_Hs01_00146430 predicted 863
6 SASI_Hs01_00146431 predicted 567
7 SASI_Hs01_00146432 predicted 640
8 SASI_Hs01_00146433 predicted 452
9 SASI_Hs01_00146434 predicted 807
10 SASI_Hs01_00146435 predicted 550
11 SASI_Hs01_00146429 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173077
CPO MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase O
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-705s1c1
Sequence:CCGGGCACTCTTATGGGCAGTTAATCTCGAGATTAACTGCCCATAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-277s1c1
Sequence:CCGGCCATCTGGTAATCCCAAGAAACTCGAGTTTCTTGGGATTACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-127s1c1
Sequence:CCGGGAGACGTATTCCTATAACATACTCGAGTATGTTATAGGAATACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-353s1c1
Sequence:CCGGGCCAATGGTTCGTCAAAGAAACTCGAGTTTCTTTGACGAACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-814s1c1
Sequence:CCGGGCAAAGTATGGAACCAATTATCTCGAGATAATTGGTTCCATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173077.2-94s21c1
Sequence:CCGGTGGAGGGCTGGGATATGATAGCTCGAGCTATCATATCCCAGCCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173077.2-494s21c1
Sequence:CCGGCTTAACATAGATGGTTATATCCTCGAGGATATAACCATCTATGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173077
CPO MISSION shRNA shRNA Plasmid DNA
carboxypeptidase O
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-705s1c1
Sequence:CCGGGCACTCTTATGGGCAGTTAATCTCGAGATTAACTGCCCATAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-277s1c1
Sequence:CCGGCCATCTGGTAATCCCAAGAAACTCGAGTTTCTTGGGATTACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-127s1c1
Sequence:CCGGGAGACGTATTCCTATAACATACTCGAGTATGTTATAGGAATACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-353s1c1
Sequence:CCGGGCCAATGGTTCGTCAAAGAAACTCGAGTTTCTTTGACGAACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-814s1c1
Sequence:CCGGGCAAAGTATGGAACCAATTATCTCGAGATAATTGGTTCCATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173077.2-94s21c1
Sequence:CCGGTGGAGGGCTGGGATATGATAGCTCGAGCTATCATATCCCAGCCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173077.2-494s21c1
Sequence:CCGGCTTAACATAGATGGTTATATCCTCGAGGATATAACCATCTATGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173077
CPO MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase O
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-705s1c1
Sequence:CCGGGCACTCTTATGGGCAGTTAATCTCGAGATTAACTGCCCATAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-277s1c1
Sequence:CCGGCCATCTGGTAATCCCAAGAAACTCGAGTTTCTTGGGATTACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-127s1c1
Sequence:CCGGGAGACGTATTCCTATAACATACTCGAGTATGTTATAGGAATACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-353s1c1
Sequence:CCGGGCCAATGGTTCGTCAAAGAAACTCGAGTTTCTTTGACGAACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173077.1-814s1c1
Sequence:CCGGGCAAAGTATGGAACCAATTATCTCGAGATAATTGGTTCCATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173077.2-94s21c1
Sequence:CCGGTGGAGGGCTGGGATATGATAGCTCGAGCTATCATATCCCAGCCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173077.2-494s21c1
Sequence:CCGGCTTAACATAGATGGTTATATCCTCGAGGATATAACCATCTATGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks