EMAIL THIS PAGE TO A FRIEND

CPOX

coproporphyrinogen oxidase

113 Gene Product Result for
Synonyms: CPO CPX HCP
UniProtKB ID: P36551, A8K275, Q14060, Q53F08, Q8IZ45, Q96AF3
Gene ID:
Human(1371) Summary: The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
Mouse(12892) coproporphyrinogen oxidase
Rat(304024) coproporphyrinogen oxidase
naked mole-rat(101704613) coproporphyrinogen oxidase
domestic guinea pig(100733319) coproporphyrinogen oxidase
sheep(101108542) coproporphyrinogen oxidase
Domestic Rabbit(100339410) coproporphyrinogen oxidase
Zebrafish(321294) coproporphyrinogen oxidase
cow(540283) coproporphyrinogen oxidase
domestic cat(101097336) coproporphyrinogen oxidase
dog(487948) coproporphyrinogen oxidase
chicken(418377) coproporphyrinogen oxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000097 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000097 Rosetta Predictions human pricing
NM_001037095 Rosetta Predictions rat pricing
NM_007757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132414 predicted 847
2 SASI_Hs01_00132415 predicted 1350
3 SASI_Hs01_00132416 predicted 1378
4 SASI_Hs01_00132417 predicted 1534
5 SASI_Hs01_00132418 predicted 1328
6 SASI_Hs01_00132419 predicted 1044
7 SASI_Hs01_00132420 predicted 1249
8 SASI_Hs01_00132421 predicted 538
9 SASI_Hs01_00132423 predicted 777
10 SASI_Hs02_00301865 predicted 830
11 SASI_Hs01_00132422 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097241 predicted 1258
2 SASI_Rn01_00097242 predicted 1288
3 SASI_Rn01_00097243 predicted 769
4 SASI_Rn01_00097244 predicted 1134
5 SASI_Rn01_00097245 predicted 1131
6 SASI_Rn01_00097246 predicted 777
7 SASI_Rn01_00097247 predicted 755
8 SASI_Rn01_00097248 predicted 742
9 SASI_Rn01_00097249 predicted 1214
10 SASI_Rn01_00097250 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055946 predicted 1268
2 SASI_Mm01_00055947 predicted 894
3 SASI_Mm01_00055948 predicted 1399
4 SASI_Mm01_00055949 predicted 628
5 SASI_Mm01_00055950 predicted 1354
6 SASI_Mm01_00055951 predicted 1104
7 SASI_Mm01_00055952 predicted 866
8 SASI_Mm01_00055953 predicted 1363
9 SASI_Mm01_00055954 predicted 989
10 SASI_Mm02_00312377 predicted 1034
11 SASI_Mm01_00055955 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007757
VALIDATED
CPOX MISSION shRNA Bacterial Glycerol Stock
coproporphyrinogen oxidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-810s21c1
Sequence:CCGGCCGTCGTTCATGGGAATCTTTCTCGAGAAAGATTCCCATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-1364s21c1
Sequence:CCGGGTGGAGTTTAATCTGTTGTATCTCGAGATACAACAGATTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-1142s21c1
Sequence:CCGGTGTGACGACTACTTCTTTATACTCGAGTATAAAGAAGTAGTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007757.2-2517s21c1
Sequence:CCGGCCCTGGATTCTGATACTTAAACTCGAGTTTAAGTATCAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007757.1-2432s1c2
Sequence:CCGGCCCTGGATTCTGATACTTAAACTCGAGTTTAAGTATCAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-724s1c1
Sequence:CCGGCCGTCGTTCATGGGAATCTTTCTCGAGAAAGATTCCCATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-1026s1c1
Sequence:CCGGCCAGACATCTACCCAAAGTTTCTCGAGAAACTTTGGGTAGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-1056s1c1
Sequence:CCGGTGTGACGACTACTTCTTTATACTCGAGTATAAAGAAGTAGTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007757.1-1278s1c1
Sequence:CCGGGTGGAGTTTAATCTGTTGTATCTCGAGATACAACAGATTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007757
VALIDATED
CPOX MISSION shRNA shRNA Plasmid DNA
coproporphyrinogen oxidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-810s21c1
Sequence:CCGGCCGTCGTTCATGGGAATCTTTCTCGAGAAAGATTCCCATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-1364s21c1
Sequence:CCGGGTGGAGTTTAATCTGTTGTATCTCGAGATACAACAGATTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-1142s21c1
Sequence:CCGGTGTGACGACTACTTCTTTATACTCGAGTATAAAGAAGTAGTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007757.2-2517s21c1
Sequence:CCGGCCCTGGATTCTGATACTTAAACTCGAGTTTAAGTATCAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007757.1-2432s1c2
Sequence:CCGGCCCTGGATTCTGATACTTAAACTCGAGTTTAAGTATCAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-724s1c1
Sequence:CCGGCCGTCGTTCATGGGAATCTTTCTCGAGAAAGATTCCCATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-1026s1c1
Sequence:CCGGCCAGACATCTACCCAAAGTTTCTCGAGAAACTTTGGGTAGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-1056s1c1
Sequence:CCGGTGTGACGACTACTTCTTTATACTCGAGTATAAAGAAGTAGTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007757.1-1278s1c1
Sequence:CCGGGTGGAGTTTAATCTGTTGTATCTCGAGATACAACAGATTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007757
VALIDATED
CPOX MISSION shRNA Lentiviral Transduction Particles
coproporphyrinogen oxidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-810s21c1
Sequence:CCGGCCGTCGTTCATGGGAATCTTTCTCGAGAAAGATTCCCATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-1364s21c1
Sequence:CCGGGTGGAGTTTAATCTGTTGTATCTCGAGATACAACAGATTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007757.2-1142s21c1
Sequence:CCGGTGTGACGACTACTTCTTTATACTCGAGTATAAAGAAGTAGTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007757.2-2517s21c1
Sequence:CCGGCCCTGGATTCTGATACTTAAACTCGAGTTTAAGTATCAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007757.1-2432s1c2
Sequence:CCGGCCCTGGATTCTGATACTTAAACTCGAGTTTAAGTATCAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-724s1c1
Sequence:CCGGCCGTCGTTCATGGGAATCTTTCTCGAGAAAGATTCCCATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-1026s1c1
Sequence:CCGGCCAGACATCTACCCAAAGTTTCTCGAGAAACTTTGGGTAGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007757.1-1056s1c1
Sequence:CCGGTGTGACGACTACTTCTTTATACTCGAGTATAAAGAAGTAGTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007757.1-1278s1c1
Sequence:CCGGGTGGAGTTTAATCTGTTGTATCTCGAGATACAACAGATTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000097
VALIDATED
CPOX MISSION shRNA Bacterial Glycerol Stock
coproporphyrinogen oxidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000097.4-2289s21c1
Sequence:CCGGGCAATGTTTCTCATTTGGAAACTCGAGTTTCCAAATGAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-939s21c1
Sequence:CCGGCCTCACTCCAACATACTTGAACTCGAGTTCAAGTATGTTGGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-716s21c1
Sequence:CCGGCTGTTGTTCATGGAAATCTTTCTCGAGAAAGATTTCCATGAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-1259s21c1
Sequence:CCGGGAGGACGGTATGTAGAATTTACTCGAGTAAATTCTACATACCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-2289s1c1
Sequence:CCGGGCAATGTTTCTCATTTGGAAACTCGAGTTTCCAAATGAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000097.4-939s1c1
Sequence:CCGGCCTCACTCCAACATACTTGAACTCGAGTTCAAGTATGTTGGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000097.4-1259s1c1
Sequence:CCGGGAGGACGGTATGTAGAATTTACTCGAGTAAATTCTACATACCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-716s1c1
Sequence:CCGGCTGTTGTTCATGGAAATCTTTCTCGAGAAAGATTTCCATGAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-864s1c1
Sequence:CCGGCCATTTCAACTACAGATACTTCTCGAGAAGTATCTGTAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000097
VALIDATED
CPOX MISSION shRNA shRNA Plasmid DNA
coproporphyrinogen oxidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000097.4-2289s21c1
Sequence:CCGGGCAATGTTTCTCATTTGGAAACTCGAGTTTCCAAATGAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-939s21c1
Sequence:CCGGCCTCACTCCAACATACTTGAACTCGAGTTCAAGTATGTTGGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-716s21c1
Sequence:CCGGCTGTTGTTCATGGAAATCTTTCTCGAGAAAGATTTCCATGAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-1259s21c1
Sequence:CCGGGAGGACGGTATGTAGAATTTACTCGAGTAAATTCTACATACCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-2289s1c1
Sequence:CCGGGCAATGTTTCTCATTTGGAAACTCGAGTTTCCAAATGAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000097.4-939s1c1
Sequence:CCGGCCTCACTCCAACATACTTGAACTCGAGTTCAAGTATGTTGGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000097.4-1259s1c1
Sequence:CCGGGAGGACGGTATGTAGAATTTACTCGAGTAAATTCTACATACCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-716s1c1
Sequence:CCGGCTGTTGTTCATGGAAATCTTTCTCGAGAAAGATTTCCATGAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-864s1c1
Sequence:CCGGCCATTTCAACTACAGATACTTCTCGAGAAGTATCTGTAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000097
VALIDATED
CPOX MISSION shRNA Lentiviral Transduction Particles
coproporphyrinogen oxidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000097.4-2289s21c1
Sequence:CCGGGCAATGTTTCTCATTTGGAAACTCGAGTTTCCAAATGAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-939s21c1
Sequence:CCGGCCTCACTCCAACATACTTGAACTCGAGTTCAAGTATGTTGGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-716s21c1
Sequence:CCGGCTGTTGTTCATGGAAATCTTTCTCGAGAAAGATTTCCATGAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000097.4-1259s21c1
Sequence:CCGGGAGGACGGTATGTAGAATTTACTCGAGTAAATTCTACATACCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-2289s1c1
Sequence:CCGGGCAATGTTTCTCATTTGGAAACTCGAGTTTCCAAATGAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000097.4-939s1c1
Sequence:CCGGCCTCACTCCAACATACTTGAACTCGAGTTCAAGTATGTTGGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000097.4-1259s1c1
Sequence:CCGGGAGGACGGTATGTAGAATTTACTCGAGTAAATTCTACATACCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-716s1c1
Sequence:CCGGCTGTTGTTCATGGAAATCTTTCTCGAGAAAGATTTCCATGAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000097.4-864s1c1
Sequence:CCGGCCATTTCAACTACAGATACTTCTCGAGAAGTATCTGTAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks