EMAIL THIS PAGE TO A FRIEND

CPPED1

calcineurin-like phosphoesterase domain containing 1

Synonyms: CSTP1
UniProtKB ID: Q9BRF8, Q6MZY9, Q9H9M9, Q9NUT6
Gene ID:
Mouse(223978) calcineurin-like phosphoesterase domain containing 1
Rat(302890) calcineurin-like phosphoesterase domain containing 1
Zebrafish(492772) calcineurin-like phosphoesterase domain containing 1
chicken(416418) calcineurin-like phosphoesterase domain containing 1
dog(479844) calcineurin-like phosphoesterase domain containing 1
cow(537938) calcineurin-like phosphoesterase domain containing 1
domestic cat(101081596) calcineurin-like phosphoesterase domain containing 1
sheep(101111418) calcineurin-like phosphoesterase domain containing 1
domestic guinea pig(100728569) calcineurin-like phosphoesterase domain containing 1
naked mole-rat(101719525) calcineurin-like phosphoesterase domain containing 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099455 Rosetta Predictions human pricing
NM_018340 Rosetta Predictions human pricing
NM_001013963 Rosetta Predictions rat pricing
NM_146067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320769 predicted 1021
2 SASI_Hs02_00320770 predicted 962
3 SASI_Hs02_00320771 predicted 956
4 SASI_Hs02_00320772 predicted 1001
5 SASI_Hs02_00320773 predicted 895
6 SASI_Hs02_00320774 predicted 988
7 SASI_Hs02_00320775 predicted 828
8 SASI_Hs02_00320776 predicted 860
9 SASI_Hs02_00320777 predicted 971
10 SASI_Hs02_00320778 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051588 predicted 1449
2 SASI_Hs02_00351786 predicted 1391
3 SASI_Hs02_00351787 predicted 1383
4 SASI_Hs02_00351788 predicted 1428
5 SASI_Hs01_00051594 predicted 1313
6 SASI_Hs01_00051595 predicted 1420
7 SASI_Hs02_00351789 predicted 1254
8 SASI_Hs01_00051596 predicted 1286
9 SASI_Hs02_00351790 predicted 1391
10 SASI_Hs02_00351791 predicted 1155
11 SASI_Hs01_00051589 predicted 538
12 SASI_Hs01_00051590 predicted 219
13 SASI_Hs01_00051591 predicted 972
14 SASI_Hs01_00051592 predicted 343
15 SASI_Hs01_00051593 predicted 223
16 SASI_Hs01_00051597 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092695 predicted 297
2 SASI_Rn01_00092697 predicted 1136
3 SASI_Rn01_00092698 predicted 1323
4 SASI_Rn01_00092699 predicted 1297
5 SASI_Rn01_00092700 predicted 1465
6 SASI_Rn01_00092701 predicted 917
7 SASI_Rn01_00092702 predicted 1083
8 SASI_Rn01_00092703 predicted 809
9 SASI_Rn01_00092704 predicted 826
10 SASI_Rn02_00201287 predicted 1447
11 SASI_Rn01_00092696 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183640 predicted 747
2 SASI_Mm01_00183642 predicted 707
3 SASI_Mm02_00341686 predicted 704
4 SASI_Mm01_00183645 predicted 844
5 SASI_Mm01_00183646 predicted 1118
6 SASI_Mm01_00183647 predicted 1108
7 SASI_Mm01_00183648 predicted 1128
8 SASI_Mm01_00183649 predicted 850
9 SASI_Mm02_00341687 predicted 1113
10 SASI_Mm02_00341688 predicted 850
11 SASI_Mm01_00183641 predicted 649
12 SASI_Mm01_00183643 predicted 328
13 SASI_Mm01_00183644 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146067
VALIDATED
CPPED1 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like phosphoesterase domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146067.2-2187s1c1
Sequence:CCGGGCCCATTATTAGGAAGCACAACTCGAGTTGTGCTTCCTAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146067.2-740s1c1
Sequence:CCGGCGACTACTTCAACCTCACTAACTCGAGTTAGTGAGGTTGAAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146067.2-936s1c1
Sequence:CCGGACTGCGGAGAAGATTGTTCATCTCGAGATGAACAATCTTCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146067.2-320s1c1
Sequence:CCGGGCTGAACCCTAAACCCAAATTCTCGAGAATTTGGGTTTAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146067.2-686s1c1
Sequence:CCGGCGCCATTGTCTTCCAGCATATCTCGAGATATGCTGGAAGACAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-935s21c1
Sequence:CCGGACTGCGGAGAAGATTGTTCATCTCGAGATGAACAATCTTCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146067.3-2186s21c1
Sequence:CCGGGCCCATTATTAGGAAGCACAACTCGAGTTGTGCTTCCTAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-319s21c1
Sequence:CCGGGCTGAACCCTAAACCCAAATTCTCGAGAATTTGGGTTTAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-685s21c1
Sequence:CCGGCGCCATTGTCTTCCAGCATATCTCGAGATATGCTGGAAGACAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-739s21c1
Sequence:CCGGCGACTACTTCAACCTCACTAACTCGAGTTAGTGAGGTTGAAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146067
VALIDATED
CPPED1 MISSION shRNA shRNA Plasmid DNA
calcineurin-like phosphoesterase domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146067.2-2187s1c1
Sequence:CCGGGCCCATTATTAGGAAGCACAACTCGAGTTGTGCTTCCTAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146067.2-740s1c1
Sequence:CCGGCGACTACTTCAACCTCACTAACTCGAGTTAGTGAGGTTGAAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146067.2-936s1c1
Sequence:CCGGACTGCGGAGAAGATTGTTCATCTCGAGATGAACAATCTTCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146067.2-320s1c1
Sequence:CCGGGCTGAACCCTAAACCCAAATTCTCGAGAATTTGGGTTTAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146067.2-686s1c1
Sequence:CCGGCGCCATTGTCTTCCAGCATATCTCGAGATATGCTGGAAGACAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-935s21c1
Sequence:CCGGACTGCGGAGAAGATTGTTCATCTCGAGATGAACAATCTTCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146067.3-2186s21c1
Sequence:CCGGGCCCATTATTAGGAAGCACAACTCGAGTTGTGCTTCCTAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-319s21c1
Sequence:CCGGGCTGAACCCTAAACCCAAATTCTCGAGAATTTGGGTTTAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-685s21c1
Sequence:CCGGCGCCATTGTCTTCCAGCATATCTCGAGATATGCTGGAAGACAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-739s21c1
Sequence:CCGGCGACTACTTCAACCTCACTAACTCGAGTTAGTGAGGTTGAAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146067
VALIDATED
CPPED1 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like phosphoesterase domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146067.2-2187s1c1
Sequence:CCGGGCCCATTATTAGGAAGCACAACTCGAGTTGTGCTTCCTAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146067.2-740s1c1
Sequence:CCGGCGACTACTTCAACCTCACTAACTCGAGTTAGTGAGGTTGAAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146067.2-936s1c1
Sequence:CCGGACTGCGGAGAAGATTGTTCATCTCGAGATGAACAATCTTCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146067.2-320s1c1
Sequence:CCGGGCTGAACCCTAAACCCAAATTCTCGAGAATTTGGGTTTAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146067.2-686s1c1
Sequence:CCGGCGCCATTGTCTTCCAGCATATCTCGAGATATGCTGGAAGACAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-935s21c1
Sequence:CCGGACTGCGGAGAAGATTGTTCATCTCGAGATGAACAATCTTCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146067.3-2186s21c1
Sequence:CCGGGCCCATTATTAGGAAGCACAACTCGAGTTGTGCTTCCTAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-319s21c1
Sequence:CCGGGCTGAACCCTAAACCCAAATTCTCGAGAATTTGGGTTTAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-685s21c1
Sequence:CCGGCGCCATTGTCTTCCAGCATATCTCGAGATATGCTGGAAGACAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146067.3-739s21c1
Sequence:CCGGCGACTACTTCAACCTCACTAACTCGAGTTAGTGAGGTTGAAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018340
VALIDATED
CPPED1 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like phosphoesterase domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-959s1c1
Sequence:CCGGGTTCACCGATACTACAGTCTACTCGAGTAGACTGTAGTATCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-805s1c1
Sequence:CCGGCGCAGGTGTCAGAGTCGTGTTCTCGAGAACACGACTCTGACACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018340.1-1013s1c1
Sequence:CCGGCTCATGGATTTGATCAAGAAACTCGAGTTTCTTGATCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-175s1c1
Sequence:CCGGCGAATGGAAAGGCCCATTCTACTCGAGTAGAATGGGCCTTTCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018340.1-583s1c1
Sequence:CCGGCAACTCCCAGTTCTACGAGAACTCGAGTTCTCGTAGAACTGGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-294s21c1
Sequence:CCGGGGAACAGGAGATCCGTCTAACCTCGAGGTTAGACGGATCTCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-351s21c1
Sequence:CCGGCAAACCCAAATTCTTCGTTCTCTCGAGAGAACGAAGAATTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1362s21c1
Sequence:CCGGATTGTATTCTGGTTAGCATATCTCGAGATATGCTAACCAGAATACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1455s21c1
Sequence:CCGGACTACACCTGATTGTATTAAACTCGAGTTTAATACAATCAGGTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-800s21c1
Sequence:CCGGAGTTGGCAGACAAGTTCATCCCTCGAGGGATGAACTTGTCTGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1204s21c1
Sequence:CCGGGGGCCCTGTCCTGAATTATATCTCGAGATATAATTCAGGACAGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018340
VALIDATED
CPPED1 MISSION shRNA shRNA Plasmid DNA
calcineurin-like phosphoesterase domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-959s1c1
Sequence:CCGGGTTCACCGATACTACAGTCTACTCGAGTAGACTGTAGTATCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-805s1c1
Sequence:CCGGCGCAGGTGTCAGAGTCGTGTTCTCGAGAACACGACTCTGACACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018340.1-1013s1c1
Sequence:CCGGCTCATGGATTTGATCAAGAAACTCGAGTTTCTTGATCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-175s1c1
Sequence:CCGGCGAATGGAAAGGCCCATTCTACTCGAGTAGAATGGGCCTTTCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018340.1-583s1c1
Sequence:CCGGCAACTCCCAGTTCTACGAGAACTCGAGTTCTCGTAGAACTGGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-294s21c1
Sequence:CCGGGGAACAGGAGATCCGTCTAACCTCGAGGTTAGACGGATCTCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-351s21c1
Sequence:CCGGCAAACCCAAATTCTTCGTTCTCTCGAGAGAACGAAGAATTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1362s21c1
Sequence:CCGGATTGTATTCTGGTTAGCATATCTCGAGATATGCTAACCAGAATACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1455s21c1
Sequence:CCGGACTACACCTGATTGTATTAAACTCGAGTTTAATACAATCAGGTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-800s21c1
Sequence:CCGGAGTTGGCAGACAAGTTCATCCCTCGAGGGATGAACTTGTCTGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1204s21c1
Sequence:CCGGGGGCCCTGTCCTGAATTATATCTCGAGATATAATTCAGGACAGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018340
VALIDATED
CPPED1 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like phosphoesterase domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-959s1c1
Sequence:CCGGGTTCACCGATACTACAGTCTACTCGAGTAGACTGTAGTATCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-805s1c1
Sequence:CCGGCGCAGGTGTCAGAGTCGTGTTCTCGAGAACACGACTCTGACACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018340.1-1013s1c1
Sequence:CCGGCTCATGGATTTGATCAAGAAACTCGAGTTTCTTGATCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018340.1-175s1c1
Sequence:CCGGCGAATGGAAAGGCCCATTCTACTCGAGTAGAATGGGCCTTTCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018340.1-583s1c1
Sequence:CCGGCAACTCCCAGTTCTACGAGAACTCGAGTTCTCGTAGAACTGGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-294s21c1
Sequence:CCGGGGAACAGGAGATCCGTCTAACCTCGAGGTTAGACGGATCTCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-351s21c1
Sequence:CCGGCAAACCCAAATTCTTCGTTCTCTCGAGAGAACGAAGAATTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1362s21c1
Sequence:CCGGATTGTATTCTGGTTAGCATATCTCGAGATATGCTAACCAGAATACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1455s21c1
Sequence:CCGGACTACACCTGATTGTATTAAACTCGAGTTTAATACAATCAGGTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018340.2-800s21c1
Sequence:CCGGAGTTGGCAGACAAGTTCATCCCTCGAGGGATGAACTTGTCTGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018340.2-1204s21c1
Sequence:CCGGGGGCCCTGTCCTGAATTATATCTCGAGATATAATTCAGGACAGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks