EMAIL THIS PAGE TO A FRIEND

CPQ

carboxypeptidase Q

96 Gene Product Result for
Synonyms: LDP PGCP
UniProtKB ID: Q9Y646, B2RD88, Q8NBZ1, Q9UNM8, Q9Y5X6
Gene ID:
Human(10404) Summary: This gene encodes a metallopeptidase that belongs to the peptidase M28 family. The encoded protein may catalyze the cleavage of dipeptides with unsubstituted terminals into amino acids. [provided by RefSeq, Jul 2013]
Mouse(54381) carboxypeptidase Q
Rat(58952) carboxypeptidase Q
naked mole-rat(101709511) carboxypeptidase Q
domestic guinea pig(100721674) carboxypeptidase Q
sheep(101107799) carboxypeptidase Q
chicken(420238) carboxypeptidase Q
domestic cat(101092662) carboxypeptidase Q
dog(477946) carboxypeptidase Q
cow(540923) plasma glutamate carboxypeptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016134 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066701 MISSION® esiRNA esiRNA targeting mouse Pgcp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016134 Rosetta Predictions human pricing
NM_031640 Rosetta Predictions rat pricing
NM_018755 Rosetta Predictions mouse pricing
NM_176073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121881 predicted 1207
2 SASI_Hs02_00348929 predicted 937
3 SASI_Hs01_00121882 predicted 949
4 SASI_Hs01_00121883 predicted 980
5 SASI_Hs02_00348930 predicted 1431
6 SASI_Hs01_00121886 predicted 1673
7 SASI_Hs01_00121887 predicted 998
8 SASI_Hs01_00121888 predicted 798
9 SASI_Hs01_00121889 predicted 1584
10 SASI_Hs02_00348931 predicted 852
11 SASI_Hs01_00121884 predicted 1518
12 SASI_Hs01_00121885 predicted 1001
13 SASI_Hs01_00121890 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066867 predicted 642
2 SASI_Rn01_00066868 predicted 1265
3 SASI_Rn01_00066869 predicted 1296
4 SASI_Rn01_00066870 predicted 831
5 SASI_Rn01_00066871 predicted 489
6 SASI_Rn02_00264947 predicted 897
7 SASI_Rn01_00066873 predicted 1509
8 SASI_Rn01_00066874 predicted 250
9 SASI_Rn01_00066875 predicted 1245
10 SASI_Rn01_00066876 predicted 939
11 SASI_Rn01_00066872 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324047 predicted 1011
2 SASI_Mm02_00324048 predicted 1477
3 SASI_Mm02_00324049 predicted 1440
4 SASI_Mm02_00324050 predicted 1518
5 SASI_Mm02_00324051 predicted 1093
6 SASI_Mm02_00324052 predicted 1425
7 SASI_Mm01_00101102 predicted 681
8 SASI_Mm02_00324053 predicted 1754
9 SASI_Mm02_00324054 predicted 544
10 SASI_Mm02_00324055 predicted 1078
11 SASI_Mm01_00101096 predicted 620
12 SASI_Mm01_00101097 predicted 579
13 SASI_Mm01_00101098 predicted 618
14 SASI_Mm01_00101099 predicted 450
15 SASI_Mm01_00101100 predicted 595
16 SASI_Mm01_00101101 predicted 618
17 SASI_Mm01_00101103 predicted 692
18 SASI_Mm01_00101104 predicted 597
19 SASI_Mm01_00101105 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346701 predicted 915
2 SASI_Mm02_00346702 predicted 1386
3 SASI_Mm02_00346703 predicted 1346
4 SASI_Mm02_00346704 predicted 1424
5 SASI_Mm02_00346705 predicted 1005
6 SASI_Mm02_00346706 predicted 1340
7 SASI_Mm01_00027103 predicted 592
8 SASI_Mm02_00346707 predicted 1671
9 SASI_Mm02_00346708 predicted 449
10 SASI_Mm02_00346709 predicted 987
11 SASI_Mm01_00027097 predicted 662
12 SASI_Mm01_00027098 predicted 629
13 SASI_Mm01_00027099 predicted 660
14 SASI_Mm01_00027100 predicted 506
15 SASI_Mm01_00027101 predicted 640
16 SASI_Mm01_00027102 predicted 677
17 SASI_Mm01_00027104 predicted 744
18 SASI_Mm01_00027105 predicted 639
19 SASI_Mm01_00027106 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018755
VALIDATED
CPQ MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase Q
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018755.2-1507s21c1
Sequence:CCGGATGGAGAAGGAACTGATATTACTCGAGTAATATCAGTTCCTTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018755.2-363s21c1
Sequence:CCGGGCTGTATTCAAGAATGGTGTTCTCGAGAACACCATTCTTGAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018755.2-389s21c1
Sequence:CCGGGCGAACATTTCGAGAAATAAACTCGAGTTTATTTCTCGAAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018755.2-1566s21c1
Sequence:CCGGCGTGATGACTTGTACAAGTATCTCGAGATACTTGTACAAGTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018755.1-1085s1c1
Sequence:CCGGCCCAGTATTATGAGCTACATACTCGAGTATGTAGCTCATAATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-154s1c1
Sequence:CCGGGCTGTATTCAAGAATGGTGTTCTCGAGAACACCATTCTTGAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-1321s1c1
Sequence:CCGGCGTGATGACTTGTACAAGTATCTCGAGATACTTGTACAAGTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-880s1c1
Sequence:CCGGCCAGATACTGATTCCTTCAATCTCGAGATTGAAGGAATCAGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-180s1c1
Sequence:CCGGGCGAACATTTCGAGAAATAAACTCGAGTTTATTTCTCGAAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018755
VALIDATED
CPQ MISSION shRNA shRNA Plasmid DNA
carboxypeptidase Q
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018755.2-1507s21c1
Sequence:CCGGATGGAGAAGGAACTGATATTACTCGAGTAATATCAGTTCCTTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018755.2-363s21c1
Sequence:CCGGGCTGTATTCAAGAATGGTGTTCTCGAGAACACCATTCTTGAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018755.2-389s21c1
Sequence:CCGGGCGAACATTTCGAGAAATAAACTCGAGTTTATTTCTCGAAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018755.2-1566s21c1
Sequence:CCGGCGTGATGACTTGTACAAGTATCTCGAGATACTTGTACAAGTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018755.1-1085s1c1
Sequence:CCGGCCCAGTATTATGAGCTACATACTCGAGTATGTAGCTCATAATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-154s1c1
Sequence:CCGGGCTGTATTCAAGAATGGTGTTCTCGAGAACACCATTCTTGAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-1321s1c1
Sequence:CCGGCGTGATGACTTGTACAAGTATCTCGAGATACTTGTACAAGTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-880s1c1
Sequence:CCGGCCAGATACTGATTCCTTCAATCTCGAGATTGAAGGAATCAGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-180s1c1
Sequence:CCGGGCGAACATTTCGAGAAATAAACTCGAGTTTATTTCTCGAAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018755
VALIDATED
CPQ MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase Q
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018755.2-1507s21c1
Sequence:CCGGATGGAGAAGGAACTGATATTACTCGAGTAATATCAGTTCCTTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018755.2-363s21c1
Sequence:CCGGGCTGTATTCAAGAATGGTGTTCTCGAGAACACCATTCTTGAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018755.2-389s21c1
Sequence:CCGGGCGAACATTTCGAGAAATAAACTCGAGTTTATTTCTCGAAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018755.2-1566s21c1
Sequence:CCGGCGTGATGACTTGTACAAGTATCTCGAGATACTTGTACAAGTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018755.1-1085s1c1
Sequence:CCGGCCCAGTATTATGAGCTACATACTCGAGTATGTAGCTCATAATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-154s1c1
Sequence:CCGGGCTGTATTCAAGAATGGTGTTCTCGAGAACACCATTCTTGAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-1321s1c1
Sequence:CCGGCGTGATGACTTGTACAAGTATCTCGAGATACTTGTACAAGTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-880s1c1
Sequence:CCGGCCAGATACTGATTCCTTCAATCTCGAGATTGAAGGAATCAGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018755.1-180s1c1
Sequence:CCGGGCGAACATTTCGAGAAATAAACTCGAGTTTATTTCTCGAAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016134
CPQ MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase Q
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-860s21c1
Sequence:CCGGGCCTGTATTACGGTGGAAGATCTCGAGATCTTCCACCGTAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-311s21c1
Sequence:CCGGGCAATCATCAACCTAGCTGTTCTCGAGAACAGCTAGGTTGATGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-426s21c1
Sequence:CCGGCCATCCAAATTATGTACCAAACTCGAGTTTGGTACATAATTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-1425s21c1
Sequence:CCGGCCAGTCTACTTGATGACTTATCTCGAGATAAGTCATCAAGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016134.2-1691s21c1
Sequence:CCGGGCACAACTCTATTTCATGCTTCTCGAGAAGCATGAAATAGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016134.2-1691s1c1
Sequence:CCGGGCACAACTCTATTTCATGCTTCTCGAGAAGCATGAAATAGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-860s1c1
Sequence:CCGGGCCTGTATTACGGTGGAAGATCTCGAGATCTTCCACCGTAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-311s1c1
Sequence:CCGGGCAATCATCAACCTAGCTGTTCTCGAGAACAGCTAGGTTGATGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-426s1c1
Sequence:CCGGCCATCCAAATTATGTACCAAACTCGAGTTTGGTACATAATTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-1425s1c1
Sequence:CCGGCCAGTCTACTTGATGACTTATCTCGAGATAAGTCATCAAGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016134
CPQ MISSION shRNA shRNA Plasmid DNA
carboxypeptidase Q
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-860s21c1
Sequence:CCGGGCCTGTATTACGGTGGAAGATCTCGAGATCTTCCACCGTAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-311s21c1
Sequence:CCGGGCAATCATCAACCTAGCTGTTCTCGAGAACAGCTAGGTTGATGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-426s21c1
Sequence:CCGGCCATCCAAATTATGTACCAAACTCGAGTTTGGTACATAATTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-1425s21c1
Sequence:CCGGCCAGTCTACTTGATGACTTATCTCGAGATAAGTCATCAAGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016134.2-1691s21c1
Sequence:CCGGGCACAACTCTATTTCATGCTTCTCGAGAAGCATGAAATAGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016134.2-1691s1c1
Sequence:CCGGGCACAACTCTATTTCATGCTTCTCGAGAAGCATGAAATAGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-860s1c1
Sequence:CCGGGCCTGTATTACGGTGGAAGATCTCGAGATCTTCCACCGTAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-311s1c1
Sequence:CCGGGCAATCATCAACCTAGCTGTTCTCGAGAACAGCTAGGTTGATGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-426s1c1
Sequence:CCGGCCATCCAAATTATGTACCAAACTCGAGTTTGGTACATAATTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-1425s1c1
Sequence:CCGGCCAGTCTACTTGATGACTTATCTCGAGATAAGTCATCAAGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016134
CPQ MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase Q
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-860s21c1
Sequence:CCGGGCCTGTATTACGGTGGAAGATCTCGAGATCTTCCACCGTAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-311s21c1
Sequence:CCGGGCAATCATCAACCTAGCTGTTCTCGAGAACAGCTAGGTTGATGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-426s21c1
Sequence:CCGGCCATCCAAATTATGTACCAAACTCGAGTTTGGTACATAATTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016134.2-1425s21c1
Sequence:CCGGCCAGTCTACTTGATGACTTATCTCGAGATAAGTCATCAAGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016134.2-1691s21c1
Sequence:CCGGGCACAACTCTATTTCATGCTTCTCGAGAAGCATGAAATAGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016134.2-1691s1c1
Sequence:CCGGGCACAACTCTATTTCATGCTTCTCGAGAAGCATGAAATAGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-860s1c1
Sequence:CCGGGCCTGTATTACGGTGGAAGATCTCGAGATCTTCCACCGTAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-311s1c1
Sequence:CCGGGCAATCATCAACCTAGCTGTTCTCGAGAACAGCTAGGTTGATGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-426s1c1
Sequence:CCGGCCATCCAAATTATGTACCAAACTCGAGTTTGGTACATAATTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016134.2-1425s1c1
Sequence:CCGGCCAGTCTACTTGATGACTTATCTCGAGATAAGTCATCAAGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks