EMAIL THIS PAGE TO A FRIEND

CPS1-IT1

CPS1 intronic transcript 1 (non-protein coding)

39 Gene Product Result for
Synonyms: CPS1-IT CPS1IT CPS1IT1 PRO0132
Species: Human CPS1-IT1(29034)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002763 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376600 predicted 554
2 SASI_Hs02_00376601 predicted 1133
3 SASI_Hs02_00376602 predicted 529
4 SASI_Hs02_00376603 predicted 1300
5 SASI_Hs02_00376604 predicted 998
6 SASI_Hs02_00376605 predicted 1284
7 SASI_Hs02_00376606 predicted 312
8 SASI_Hs02_00376607 predicted 1278
9 SASI_Hs02_00376608 predicted 1450
10 SASI_Hs02_00376609 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014116
CPS1-IT1 MISSION shRNA Bacterial Glycerol Stock
CPS1 intronic transcript 1 (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1731s1c1
Sequence:CCGGCCTCTTTCATTTCTCCAGATTCTCGAGAATCTGGAGAAATGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1656s1c1
Sequence:CCGGTGCATTGGAAGGAGCAGACTACTCGAGTAGTCTGCTCCTTCCAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1680s1c1
Sequence:CCGGAGCCAGAGATTGGTGCGCAGTCTCGAGACTGCGCACCAATCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1720s1c1
Sequence:CCGGGACGTACATCACCTCTTTCATCTCGAGATGAAAGAGGTGATGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1705s1c1
Sequence:CCGGCCCACTGTAGAATCAGACGTACTCGAGTACGTCTGATTCTACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014116
CPS1-IT1 MISSION shRNA shRNA Plasmid DNA
CPS1 intronic transcript 1 (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1731s1c1
Sequence:CCGGCCTCTTTCATTTCTCCAGATTCTCGAGAATCTGGAGAAATGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1656s1c1
Sequence:CCGGTGCATTGGAAGGAGCAGACTACTCGAGTAGTCTGCTCCTTCCAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1680s1c1
Sequence:CCGGAGCCAGAGATTGGTGCGCAGTCTCGAGACTGCGCACCAATCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1720s1c1
Sequence:CCGGGACGTACATCACCTCTTTCATCTCGAGATGAAAGAGGTGATGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1705s1c1
Sequence:CCGGCCCACTGTAGAATCAGACGTACTCGAGTACGTCTGATTCTACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014116
CPS1-IT1 MISSION shRNA Lentiviral Transduction Particles
CPS1 intronic transcript 1 (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1731s1c1
Sequence:CCGGCCTCTTTCATTTCTCCAGATTCTCGAGAATCTGGAGAAATGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1656s1c1
Sequence:CCGGTGCATTGGAAGGAGCAGACTACTCGAGTAGTCTGCTCCTTCCAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1680s1c1
Sequence:CCGGAGCCAGAGATTGGTGCGCAGTCTCGAGACTGCGCACCAATCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1720s1c1
Sequence:CCGGGACGTACATCACCTCTTTCATCTCGAGATGAAAGAGGTGATGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014116.1-1705s1c1
Sequence:CCGGCCCACTGTAGAATCAGACGTACTCGAGTACGTCTGATTCTACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks