EMAIL THIS PAGE TO A FRIEND

CPS1

carbamoyl-phosphate synthase 1, mitochondrial

102 Gene Product Result for
Synonyms: CPSASE1 PHN
Gene ID:
Human(1373) Summary: The mitochondrial enzyme encoded by this gene catalyzes synthesis of carbamoyl phosphate from ammonia and bicarbonate. This reaction is the first committed step of the urea cycle, which is important in the removal of excess urea from cells. The encoded protein may also represent a core mitochondrial nucleoid protein. Three transcript variants encoding different isoforms have been found for this gene. The shortest isoform may not be localized to the mitochondrion. Mutations in this gene have been associated with carbamoyl phosphate synthetase deficiency, susceptibility to persistent pulmonary hypertension, and susceptibility to venoocclusive disease after bone marrow transplantation.[provided by RefSeq, May 2010]
Mouse(227231) carbamoyl-phosphate synthetase 1
Rat(497840) carbamoyl-phosphate synthetase 1
Zebrafish(555623) carbamoyl-phosphate synthase 1, mitochondrial
cow(510506) carbamoyl-phosphate synthase 1, mitochondrial
Horse(100050116) carbamoyl-phosphate synthase 1, mitochondrial
domestic cat(101099824) carbamoyl-phosphate synthase 1, mitochondrial
dog(488506) carbamoyl-phosphate synthase 1, mitochondrial
chicken(428994) carbamoyl-phosphate synthase 1, mitochondrial
sheep(101107584) carbamoyl-phosphate synthase 1, mitochondrial
domestic guinea pig(100723563) carbamoyl-phosphate synthase 1, mitochondrial
naked mole-rat(101696508) carbamoyl-phosphate synthase 1, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002511 MISSION® esiRNA esiRNA targeting human CPS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122633 Rosetta Predictions human pricing
NM_001122634 Rosetta Predictions human pricing
NM_001875 Rosetta Predictions human pricing
NM_017072 Rosetta Predictions rat pricing
XM_579392 Rosetta Predictions rat pricing
NM_001080809 Rosetta Predictions mouse pricing
XM_129769 Rosetta Predictions mouse pricing
XM_901578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327106 predicted 3545
2 SASI_Hs02_00327107 predicted 2141
3 SASI_Hs02_00327108 predicted 4015
4 SASI_Hs02_00327109 predicted 3216
5 SASI_Hs02_00327110 predicted 2703
6 SASI_Hs02_00327111 predicted 2437
7 SASI_Hs02_00327112 predicted 1498
8 SASI_Hs02_00327113 predicted 3855
9 SASI_Hs02_00327114 predicted 1704
10 SASI_Hs02_00327115 predicted 3990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327116 predicted 2596
2 SASI_Hs02_00327117 predicted 1186
3 SASI_Hs02_00327118 predicted 3062
4 SASI_Hs02_00327119 predicted 2263
5 SASI_Hs02_00327120 predicted 1747
6 SASI_Hs02_00327121 predicted 1487
7 SASI_Hs02_00327122 predicted 545
8 SASI_Hs02_00327123 predicted 2904
9 SASI_Hs02_00327124 predicted 755
10 SASI_Hs02_00327125 predicted 3040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049494 predicted 3579
2 SASI_Hs01_00049496 predicted 2175
3 SASI_Hs01_00049497 predicted 4044
4 SASI_Hs02_00332723 predicted 3249
5 SASI_Hs01_00049499 predicted 2736
6 SASI_Hs01_00049500 predicted 2472
7 SASI_Hs01_00049501 predicted 1535
8 SASI_Hs02_00332724 predicted 3888
9 SASI_Hs01_00049502 predicted 1741
10 SASI_Hs02_00332725 predicted 4028
11 SASI_Hs01_00049495 predicted 491
12 SASI_Hs01_00049498 predicted 818
13 SASI_Hs01_00049503 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120465 predicted 2546
2 SASI_Rn01_00120466 predicted 1440
3 SASI_Rn02_00261276 predicted 568
4 SASI_Rn01_00120467 predicted 1671
5 SASI_Rn01_00120468 predicted 2049
6 SASI_Rn02_00261277 predicted 4040
7 SASI_Rn02_00261278 predicted 3905
8 SASI_Rn01_00120470 predicted 808
9 SASI_Rn01_00120471 predicted 2335
10 SASI_Rn01_00120474 predicted 2674
11 SASI_Rn01_00120469 predicted 1755
12 SASI_Rn01_00120472 predicted 3971
13 SASI_Rn01_00120473 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195691 predicted 2550
2 SASI_Rn01_00195692 predicted 1441
3 SASI_Rn01_00195693 predicted 572
4 SASI_Rn01_00195694 predicted 1675
5 SASI_Rn01_00195695 predicted 2046
6 SASI_Rn01_00195696 predicted 1753
7 SASI_Rn01_00195697 predicted 816
8 SASI_Rn01_00195698 predicted 2346
9 SASI_Rn01_00195699 predicted 2073
10 SASI_Rn01_00195700 predicted 2677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293833 predicted 3998
2 SASI_Mm02_00293834 predicted 4064
3 SASI_Mm02_00293835 predicted 1913
4 SASI_Mm02_00293836 predicted 1891
5 SASI_Mm02_00293837 predicted 4016
6 SASI_Mm02_00293838 predicted 2167
7 SASI_Mm02_00293839 predicted 344
8 SASI_Mm02_00293840 predicted 2678
9 SASI_Mm02_00293841 predicted 914
10 SASI_Mm02_00293842 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281178 predicted 4047
2 SASI_Mm01_00281179 predicted 4107
3 SASI_Mm01_00281180 predicted 1948
4 SASI_Mm01_00281181 predicted 1938
5 SASI_Mm01_00281182 predicted 4055
6 SASI_Mm01_00281183 predicted 385
7 SASI_Mm01_00281184 predicted 716
8 SASI_Mm01_00281185 predicted 2721
9 SASI_Mm01_00281186 predicted 950
10 SASI_Mm01_00281187 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236443 predicted 1000
2 SASI_Mm01_00236444 predicted 955
3 SASI_Mm01_00236445 predicted 1062
4 SASI_Mm01_00236446 predicted 1052
5 SASI_Mm01_00236447 predicted 1019
6 SASI_Mm01_00236448 predicted 1470
7 SASI_Mm01_00236449 predicted 810
8 SASI_Mm01_00236450 predicted 818
9 SASI_Mm01_00236451 predicted 1153
10 SASI_Mm01_00236452 predicted 1119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001875
CPS1 MISSION shRNA Bacterial Glycerol Stock
carbamoyl-phosphate synthase 1, mitochondrial
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-412s1c1
Sequence:CCGGGCCAACCCTATTATTGGGAATCTCGAGATTCCCAATAATAGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-2167s1c1
Sequence:CCGGCGTACTTCAATCAATGTTGTTCTCGAGAACAACATTGATTGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-1698s1c1
Sequence:CCGGGCTCAAGGAATATGGTGTGAACTCGAGTTCACACCATATTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-4133s1c1
Sequence:CCGGGCTTTGGTGAAGGTATTCATACTCGAGTATGAATACCTTCACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-2365s1c1
Sequence:CCGGCCAGAAATTAAGAACGTCGTACTCGAGTACGACGTTCTTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001875.3-3844s21c1
Sequence:CCGGGGTCCATTCAACGTCCAATTTCTCGAGAAATTGGACGTTGAATGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001875.3-1627s21c1
Sequence:CCGGGAACAGCCAGATGGGTTAATTCTCGAGAATTAACCCATCTGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001875
CPS1 MISSION shRNA shRNA Plasmid DNA
carbamoyl-phosphate synthase 1, mitochondrial
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-412s1c1
Sequence:CCGGGCCAACCCTATTATTGGGAATCTCGAGATTCCCAATAATAGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-2167s1c1
Sequence:CCGGCGTACTTCAATCAATGTTGTTCTCGAGAACAACATTGATTGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-1698s1c1
Sequence:CCGGGCTCAAGGAATATGGTGTGAACTCGAGTTCACACCATATTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-4133s1c1
Sequence:CCGGGCTTTGGTGAAGGTATTCATACTCGAGTATGAATACCTTCACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-2365s1c1
Sequence:CCGGCCAGAAATTAAGAACGTCGTACTCGAGTACGACGTTCTTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001875.3-3844s21c1
Sequence:CCGGGGTCCATTCAACGTCCAATTTCTCGAGAAATTGGACGTTGAATGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001875.3-1627s21c1
Sequence:CCGGGAACAGCCAGATGGGTTAATTCTCGAGAATTAACCCATCTGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001875
CPS1 MISSION shRNA Lentiviral Transduction Particles
carbamoyl-phosphate synthase 1, mitochondrial
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-412s1c1
Sequence:CCGGGCCAACCCTATTATTGGGAATCTCGAGATTCCCAATAATAGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-2167s1c1
Sequence:CCGGCGTACTTCAATCAATGTTGTTCTCGAGAACAACATTGATTGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-1698s1c1
Sequence:CCGGGCTCAAGGAATATGGTGTGAACTCGAGTTCACACCATATTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-4133s1c1
Sequence:CCGGGCTTTGGTGAAGGTATTCATACTCGAGTATGAATACCTTCACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001875.2-2365s1c1
Sequence:CCGGCCAGAAATTAAGAACGTCGTACTCGAGTACGACGTTCTTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001875.3-3844s21c1
Sequence:CCGGGGTCCATTCAACGTCCAATTTCTCGAGAAATTGGACGTTGAATGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001875.3-1627s21c1
Sequence:CCGGGAACAGCCAGATGGGTTAATTCTCGAGAATTAACCCATCTGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080809
CPS1 MISSION shRNA Bacterial Glycerol Stock
carbamoyl-phosphate synthase 1, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1899s21c1
Sequence:CCGGTCCCAATAAGGAGACCTTAATCTCGAGATTAAGGTCTCCTTATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1704s21c1
Sequence:CCGGCACATCAGTTGAGTCCATTATCTCGAGATAATGGACTCAACTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1542s21c1
Sequence:CCGGAGTCTACTTTCTCCCTATTACCTCGAGGTAATAGGGAGAAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-789s21c1
Sequence:CCGGTGTCATCCGCCTGCTAGTTAACTCGAGTTAACTAGCAGGCGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-904s21c1
Sequence:CCGGGCTCTTGCACAGCCACTAATTCTCGAGAATTAGTGGCTGTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080809
CPS1 MISSION shRNA shRNA Plasmid DNA
carbamoyl-phosphate synthase 1, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1899s21c1
Sequence:CCGGTCCCAATAAGGAGACCTTAATCTCGAGATTAAGGTCTCCTTATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1704s21c1
Sequence:CCGGCACATCAGTTGAGTCCATTATCTCGAGATAATGGACTCAACTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1542s21c1
Sequence:CCGGAGTCTACTTTCTCCCTATTACCTCGAGGTAATAGGGAGAAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-789s21c1
Sequence:CCGGTGTCATCCGCCTGCTAGTTAACTCGAGTTAACTAGCAGGCGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-904s21c1
Sequence:CCGGGCTCTTGCACAGCCACTAATTCTCGAGAATTAGTGGCTGTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080809
CPS1 MISSION shRNA Lentiviral Transduction Particles
carbamoyl-phosphate synthase 1, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1899s21c1
Sequence:CCGGTCCCAATAAGGAGACCTTAATCTCGAGATTAAGGTCTCCTTATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1704s21c1
Sequence:CCGGCACATCAGTTGAGTCCATTATCTCGAGATAATGGACTCAACTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-1542s21c1
Sequence:CCGGAGTCTACTTTCTCCCTATTACCTCGAGGTAATAGGGAGAAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-789s21c1
Sequence:CCGGTGTCATCCGCCTGCTAGTTAACTCGAGTTAACTAGCAGGCGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080809.1-904s21c1
Sequence:CCGGGCTCTTGCACAGCCACTAATTCTCGAGAATTAGTGGCTGTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks