EMAIL THIS PAGE TO A FRIEND

CPSF1

cleavage and polyadenylation specific factor 1, 160kDa

51 Gene Product Result for
Synonyms: CPSF160 HSU37012 P/cl.18
UniProtKB ID: Q10570, Q96AF0
Gene ID:
Human(29894) Summary: Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]
Mouse(94230) cleavage and polyadenylation specific factor 1
Rat(366952) cleavage and polyadenylation specific factor 1, 160kDa
Zebrafish(432372) cleavage and polyadenylation specific factor 1
cow(282703) cleavage and polyadenylation specific factor 1, 160kDa
domestic cat(101096701) cleavage and polyadenylation specific factor 1, 160kDa
dog(475126) cleavage and polyadenylation specific factor 1, 160kDa
naked mole-rat(101720593) cleavage and polyadenylation specific factor 1, 160kDa
domestic guinea pig(100715105) cleavage and polyadenylation specific factor 1, 160kDa
sheep(101108319) cleavage and polyadenylation specific factor 1, 160kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013291 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013291 Rosetta Predictions human pricing
NM_001130571 Rosetta Predictions rat pricing
NM_053193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075334 predicted 2742
2 SASI_Hs01_00075335 predicted 3147
3 SASI_Hs01_00075336 predicted 3755
4 SASI_Hs01_00075337 predicted 782
5 SASI_Hs02_00344563 predicted 284
6 SASI_Hs01_00075339 predicted 804
7 SASI_Hs01_00075340 predicted 1237
8 SASI_Hs01_00075341 predicted 2998
9 SASI_Hs01_00075342 predicted 1665
10 SASI_Hs01_00075343 predicted 1367
11 SASI_Hs01_00075338 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255879 predicted 2102
2 SASI_Rn02_00255880 predicted 973
3 SASI_Rn02_00255881 predicted 3275
4 SASI_Rn02_00255882 predicted 748
5 SASI_Rn02_00255883 predicted 3225
6 SASI_Rn02_00255884 predicted 1967
7 SASI_Rn02_00255885 predicted 964
8 SASI_Rn02_00255886 predicted 605
9 SASI_Rn02_00255887 predicted 3284
10 SASI_Rn02_00255888 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043868 predicted 2068
2 SASI_Mm01_00043869 predicted 2869
3 SASI_Mm02_00337762 predicted 806
4 SASI_Mm01_00043871 predicted 3235
5 SASI_Mm01_00043872 predicted 3547
6 SASI_Mm01_00043873 predicted 553
7 SASI_Mm01_00043874 predicted 912
8 SASI_Mm01_00043876 predicted 1186
9 SASI_Mm01_00043877 predicted 1471
10 SASI_Mm02_00337763 predicted 1689
11 SASI_Mm01_00043870 predicted 3780
12 SASI_Mm01_00043875 predicted 1790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053193
VALIDATED
CPSF1 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 1, 160kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053193.1-3903s1c1
Sequence:CCGGCCGCAATCTTATGGTGTATATCTCGAGATATACACCATAAGATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-2484s1c1
Sequence:CCGGGCGGCTGGTATTCCTAGTTAACTCGAGTTAACTAGGAATACCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053193.1-1155s1c1
Sequence:CCGGCCGAGCGTTTCACTTTGACAACTCGAGTTGTCAAAGTGAAACGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-4354s1c1
Sequence:CCGGCCTGACATTATCCTGGATGATCTCGAGATCATCCAGGATAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-2607s1c1
Sequence:CCGGGCCTTTGGTTAAGGAGGTGTTCTCGAGAACACCTCCTTAACCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-3903s21c1
Sequence:CCGGCCGCAATCTTATGGTGTATATCTCGAGATATACACCATAAGATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-2485s21c1
Sequence:CCGGCGGCTGGTATTCCTAGTTAAGCTCGAGCTTAACTAGGAATACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-3256s21c1
Sequence:CCGGATTGAGAGAGACGACAGATACCTCGAGGTATCTGTCGTCTCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-2870s21c1
Sequence:CCGGTCCGCTACTTTGAGGATATTTCTCGAGAAATATCCTCAAAGTAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-4284s21c1
Sequence:CCGGACTGCTAAACCGCTACCTATACTCGAGTATAGGTAGCGGTTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053193
VALIDATED
CPSF1 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 1, 160kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053193.1-3903s1c1
Sequence:CCGGCCGCAATCTTATGGTGTATATCTCGAGATATACACCATAAGATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-2484s1c1
Sequence:CCGGGCGGCTGGTATTCCTAGTTAACTCGAGTTAACTAGGAATACCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053193.1-1155s1c1
Sequence:CCGGCCGAGCGTTTCACTTTGACAACTCGAGTTGTCAAAGTGAAACGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-4354s1c1
Sequence:CCGGCCTGACATTATCCTGGATGATCTCGAGATCATCCAGGATAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-2607s1c1
Sequence:CCGGGCCTTTGGTTAAGGAGGTGTTCTCGAGAACACCTCCTTAACCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-3903s21c1
Sequence:CCGGCCGCAATCTTATGGTGTATATCTCGAGATATACACCATAAGATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-2485s21c1
Sequence:CCGGCGGCTGGTATTCCTAGTTAAGCTCGAGCTTAACTAGGAATACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-3256s21c1
Sequence:CCGGATTGAGAGAGACGACAGATACCTCGAGGTATCTGTCGTCTCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-2870s21c1
Sequence:CCGGTCCGCTACTTTGAGGATATTTCTCGAGAAATATCCTCAAAGTAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-4284s21c1
Sequence:CCGGACTGCTAAACCGCTACCTATACTCGAGTATAGGTAGCGGTTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053193
VALIDATED
CPSF1 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 1, 160kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053193.1-3903s1c1
Sequence:CCGGCCGCAATCTTATGGTGTATATCTCGAGATATACACCATAAGATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-2484s1c1
Sequence:CCGGGCGGCTGGTATTCCTAGTTAACTCGAGTTAACTAGGAATACCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053193.1-1155s1c1
Sequence:CCGGCCGAGCGTTTCACTTTGACAACTCGAGTTGTCAAAGTGAAACGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-4354s1c1
Sequence:CCGGCCTGACATTATCCTGGATGATCTCGAGATCATCCAGGATAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053193.1-2607s1c1
Sequence:CCGGGCCTTTGGTTAAGGAGGTGTTCTCGAGAACACCTCCTTAACCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-3903s21c1
Sequence:CCGGCCGCAATCTTATGGTGTATATCTCGAGATATACACCATAAGATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-2485s21c1
Sequence:CCGGCGGCTGGTATTCCTAGTTAAGCTCGAGCTTAACTAGGAATACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-3256s21c1
Sequence:CCGGATTGAGAGAGACGACAGATACCTCGAGGTATCTGTCGTCTCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-2870s21c1
Sequence:CCGGTCCGCTACTTTGAGGATATTTCTCGAGAAATATCCTCAAAGTAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053193.1-4284s21c1
Sequence:CCGGACTGCTAAACCGCTACCTATACTCGAGTATAGGTAGCGGTTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013291
VALIDATED
CPSF1 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 1, 160kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-4396s1c1
Sequence:CCGGCACCACCAGCACACGGAACTACTCGAGTAGTTCCGTGTGCTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-2844s1c1
Sequence:CCGGCCGCTACTTCGAGGATATTTACTCGAGTAAATATCCTCGAAGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-1032s1c1
Sequence:CCGGCACCTTCATCTCCTACGACAACTCGAGTTGTCGTAGGAGATGAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-439s1c1
Sequence:CCGGGACGGGTTTGTGCAGAATGTACTCGAGTACATTCTGCACAAACCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-2737s1c1
Sequence:CCGGCCTCACAACATCAACTTCCGTCTCGAGACGGAAGTTGATGTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-1056s21c1
Sequence:CCGGCACCTTCATCTCCTACGACAACTCGAGTTGTCGTAGGAGATGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-463s21c1
Sequence:CCGGGACGGGTTTGTGCAGAATGTACTCGAGTACATTCTGCACAAACCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-2868s21c1
Sequence:CCGGCCGCTACTTCGAGGATATTTACTCGAGTAAATATCCTCGAAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013291.2-4423s21c1
Sequence:CCGGCACCACCAGCACACGGAACTACTCGAGTAGTTCCGTGTGCTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013291
VALIDATED
CPSF1 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 1, 160kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-4396s1c1
Sequence:CCGGCACCACCAGCACACGGAACTACTCGAGTAGTTCCGTGTGCTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-2844s1c1
Sequence:CCGGCCGCTACTTCGAGGATATTTACTCGAGTAAATATCCTCGAAGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-1032s1c1
Sequence:CCGGCACCTTCATCTCCTACGACAACTCGAGTTGTCGTAGGAGATGAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-439s1c1
Sequence:CCGGGACGGGTTTGTGCAGAATGTACTCGAGTACATTCTGCACAAACCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-2737s1c1
Sequence:CCGGCCTCACAACATCAACTTCCGTCTCGAGACGGAAGTTGATGTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-1056s21c1
Sequence:CCGGCACCTTCATCTCCTACGACAACTCGAGTTGTCGTAGGAGATGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-463s21c1
Sequence:CCGGGACGGGTTTGTGCAGAATGTACTCGAGTACATTCTGCACAAACCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-2868s21c1
Sequence:CCGGCCGCTACTTCGAGGATATTTACTCGAGTAAATATCCTCGAAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013291.2-4423s21c1
Sequence:CCGGCACCACCAGCACACGGAACTACTCGAGTAGTTCCGTGTGCTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013291
VALIDATED
CPSF1 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 1, 160kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-4396s1c1
Sequence:CCGGCACCACCAGCACACGGAACTACTCGAGTAGTTCCGTGTGCTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-2844s1c1
Sequence:CCGGCCGCTACTTCGAGGATATTTACTCGAGTAAATATCCTCGAAGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-1032s1c1
Sequence:CCGGCACCTTCATCTCCTACGACAACTCGAGTTGTCGTAGGAGATGAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-439s1c1
Sequence:CCGGGACGGGTTTGTGCAGAATGTACTCGAGTACATTCTGCACAAACCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013291.x-2737s1c1
Sequence:CCGGCCTCACAACATCAACTTCCGTCTCGAGACGGAAGTTGATGTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-1056s21c1
Sequence:CCGGCACCTTCATCTCCTACGACAACTCGAGTTGTCGTAGGAGATGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-463s21c1
Sequence:CCGGGACGGGTTTGTGCAGAATGTACTCGAGTACATTCTGCACAAACCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013291.2-2868s21c1
Sequence:CCGGCCGCTACTTCGAGGATATTTACTCGAGTAAATATCCTCGAAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013291.2-4423s21c1
Sequence:CCGGCACCACCAGCACACGGAACTACTCGAGTAGTTCCGTGTGCTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks