EMAIL THIS PAGE TO A FRIEND

CPSF2

cleavage and polyadenylation specific factor 2, 100kDa

117 Gene Product Result for
Synonyms: CPSF100
UniProtKB ID: Q9P2I0, B3KME1, Q6NSJ1, Q9H3W7
Gene ID:
Mouse(51786) cleavage and polyadenylation specific factor 2
Rat(299256) cleavage and polyadenylation specific factor 2, 100kDa
Zebrafish(436657) cleavage and polyadenylation specific factor 2
cow(327689) cleavage and polyadenylation specific factor 2, 100kDa
domestic cat(101097813) cleavage and polyadenylation specific factor 2, 100kDa
dog(480230) cleavage and polyadenylation specific factor 2, 100kDa
chicken(423416) cleavage and polyadenylation specific factor 2, 100kDa
sheep(101113701) cleavage and polyadenylation specific factor 2, 100kDa
domestic guinea pig(100718906) cleavage and polyadenylation specific factor 2, 100kDa
naked mole-rat(101696793) cleavage and polyadenylation specific factor 2, 100kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017437 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006021 MISSION® esiRNA esiRNA targeting human CPSF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017437 Rosetta Predictions human pricing
NM_001106753 Rosetta Predictions rat pricing
NM_016856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036848 predicted 967
2 SASI_Hs01_00036850 predicted 2122
3 SASI_Hs02_00350015 predicted 1475
4 SASI_Hs01_00036851 predicted 1911
5 SASI_Hs01_00036852 predicted 537
6 SASI_Hs01_00036853 predicted 763
7 SASI_Hs01_00036854 predicted 1080
8 SASI_Hs02_00350016 predicted 1303
9 SASI_Hs02_00350017 predicted 2509
10 SASI_Hs02_00350018 predicted 2237
11 SASI_Hs01_00036846 predicted 470
12 SASI_Hs01_00036847 predicted 1033
13 SASI_Hs01_00036849 predicted 1327
14 SASI_Hs01_00036855 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222058 predicted 669
2 SASI_Rn02_00222059 predicted 915
3 SASI_Rn02_00222060 predicted 1344
4 SASI_Rn02_00222061 predicted 435
5 SASI_Rn02_00222062 predicted 1615
6 SASI_Rn02_00222063 predicted 759
7 SASI_Rn02_00222064 predicted 1246
8 SASI_Rn02_00222065 predicted 477
9 SASI_Rn02_00222066 predicted 1604
10 SASI_Rn02_00222067 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163025 predicted 2438
2 SASI_Mm01_00163026 predicted 576
3 SASI_Mm01_00163028 predicted 470
4 SASI_Mm01_00163029 predicted 906
5 SASI_Mm01_00163030 predicted 1608
6 SASI_Mm01_00163031 predicted 1217
7 SASI_Mm01_00163032 predicted 1574
8 SASI_Mm01_00163033 predicted 1015
9 SASI_Mm01_00163034 predicted 2383
10 SASI_Mm02_00323634 predicted 2329
11 SASI_Mm01_00163027 predicted 1912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017437
VALIDATED
CPSF2 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 2, 100kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-2456s21c1
Sequence:CCGGGTGTACTTGTTTGCAACAATCCTCGAGGATTGTTGCAAACAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017437.1-2968s21c1
Sequence:CCGGGGAATGATAAGTGAGAATTATCTCGAGATAATTCTCACTTATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017437.1-3065s21c1
Sequence:CCGGGCTATGACTCTCTCCAGTTTGCTCGAGCAAACTGGAGAGAGTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-473s21c1
Sequence:CCGGGTCTGAACTGTGCTATCTATGCTCGAGCATAGATAGCACAGTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-695s21c1
Sequence:CCGGATATGATAGGTGGAACAATATCTCGAGATATTGTTCCACCTATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-3745s1c1
Sequence:CCGGGCCCTCTTCTTTACTCTTAATCTCGAGATTAAGAGTAAAGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-1836s1c1
Sequence:CCGGCCGGGTTACCTACATAGACTACTCGAGTAGTCTATGTAGGTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-2236s1c1
Sequence:CCGGCCCTCAGATTCTAGCGTTATACTCGAGTATAACGCTAGAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-1837s1c1
Sequence:CCGGCGGGTTACCTACATAGACTATCTCGAGATAGTCTATGTAGGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-825s1c1
Sequence:CCGGCCTACTTATCACAGATTCATTCTCGAGAATGAATCTGTGATAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017437
VALIDATED
CPSF2 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 2, 100kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-2456s21c1
Sequence:CCGGGTGTACTTGTTTGCAACAATCCTCGAGGATTGTTGCAAACAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017437.1-2968s21c1
Sequence:CCGGGGAATGATAAGTGAGAATTATCTCGAGATAATTCTCACTTATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017437.1-3065s21c1
Sequence:CCGGGCTATGACTCTCTCCAGTTTGCTCGAGCAAACTGGAGAGAGTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-473s21c1
Sequence:CCGGGTCTGAACTGTGCTATCTATGCTCGAGCATAGATAGCACAGTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-695s21c1
Sequence:CCGGATATGATAGGTGGAACAATATCTCGAGATATTGTTCCACCTATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-3745s1c1
Sequence:CCGGGCCCTCTTCTTTACTCTTAATCTCGAGATTAAGAGTAAAGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-1836s1c1
Sequence:CCGGCCGGGTTACCTACATAGACTACTCGAGTAGTCTATGTAGGTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-2236s1c1
Sequence:CCGGCCCTCAGATTCTAGCGTTATACTCGAGTATAACGCTAGAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-1837s1c1
Sequence:CCGGCGGGTTACCTACATAGACTATCTCGAGATAGTCTATGTAGGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-825s1c1
Sequence:CCGGCCTACTTATCACAGATTCATTCTCGAGAATGAATCTGTGATAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017437
VALIDATED
CPSF2 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 2, 100kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-2456s21c1
Sequence:CCGGGTGTACTTGTTTGCAACAATCCTCGAGGATTGTTGCAAACAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017437.1-2968s21c1
Sequence:CCGGGGAATGATAAGTGAGAATTATCTCGAGATAATTCTCACTTATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017437.1-3065s21c1
Sequence:CCGGGCTATGACTCTCTCCAGTTTGCTCGAGCAAACTGGAGAGAGTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-473s21c1
Sequence:CCGGGTCTGAACTGTGCTATCTATGCTCGAGCATAGATAGCACAGTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017437.1-695s21c1
Sequence:CCGGATATGATAGGTGGAACAATATCTCGAGATATTGTTCCACCTATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-3745s1c1
Sequence:CCGGGCCCTCTTCTTTACTCTTAATCTCGAGATTAAGAGTAAAGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-1836s1c1
Sequence:CCGGCCGGGTTACCTACATAGACTACTCGAGTAGTCTATGTAGGTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-2236s1c1
Sequence:CCGGCCCTCAGATTCTAGCGTTATACTCGAGTATAACGCTAGAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-1837s1c1
Sequence:CCGGCGGGTTACCTACATAGACTATCTCGAGATAGTCTATGTAGGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017437.1-825s1c1
Sequence:CCGGCCTACTTATCACAGATTCATTCTCGAGAATGAATCTGTGATAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016856
VALIDATED
CPSF2 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 2, 100kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-1262s21c1
Sequence:CCGGGCACGTTTCTTAATCGATAATCTCGAGATTATCGATTAAGAAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016856.2-480s21c1
Sequence:CCGGCTCGACACAATACAGAAGATTCTCGAGAATCTTCTGTATTGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-2882s21c1
Sequence:CCGGGCTCATTACTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016856.2-702s21c1
Sequence:CCGGACAAGAGGGAGATCCACTTAACTCGAGTTAAGTGGATCTCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-413s21c1
Sequence:CCGGTGTGCCATCTATGCAACAATTCTCGAGAATTGTTGCATAGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-2882s1c1
Sequence:CCGGGCTCATTACTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016856.2-585s1c1
Sequence:CCGGGCAAAGGACATGGTTTGTCTACTCGAGTAGACAAACCATGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-480s1c1
Sequence:CCGGCTCGACACAATACAGAAGATTCTCGAGAATCTTCTGTATTGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016856.2-1284s1c1
Sequence:CCGGCTACTGAGAAAGTTACAGAAACTCGAGTTTCTGTAACTTTCTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-2054s1c1
Sequence:CCGGGCTTGGATAGATGGCGTCTTACTCGAGTAAGACGCCATCTATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016856
VALIDATED
CPSF2 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 2, 100kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-1262s21c1
Sequence:CCGGGCACGTTTCTTAATCGATAATCTCGAGATTATCGATTAAGAAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016856.2-480s21c1
Sequence:CCGGCTCGACACAATACAGAAGATTCTCGAGAATCTTCTGTATTGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-2882s21c1
Sequence:CCGGGCTCATTACTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016856.2-702s21c1
Sequence:CCGGACAAGAGGGAGATCCACTTAACTCGAGTTAAGTGGATCTCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-413s21c1
Sequence:CCGGTGTGCCATCTATGCAACAATTCTCGAGAATTGTTGCATAGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-2882s1c1
Sequence:CCGGGCTCATTACTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016856.2-585s1c1
Sequence:CCGGGCAAAGGACATGGTTTGTCTACTCGAGTAGACAAACCATGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-480s1c1
Sequence:CCGGCTCGACACAATACAGAAGATTCTCGAGAATCTTCTGTATTGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016856.2-1284s1c1
Sequence:CCGGCTACTGAGAAAGTTACAGAAACTCGAGTTTCTGTAACTTTCTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-2054s1c1
Sequence:CCGGGCTTGGATAGATGGCGTCTTACTCGAGTAAGACGCCATCTATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016856
VALIDATED
CPSF2 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 2, 100kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-1262s21c1
Sequence:CCGGGCACGTTTCTTAATCGATAATCTCGAGATTATCGATTAAGAAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016856.2-480s21c1
Sequence:CCGGCTCGACACAATACAGAAGATTCTCGAGAATCTTCTGTATTGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-2882s21c1
Sequence:CCGGGCTCATTACTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016856.2-702s21c1
Sequence:CCGGACAAGAGGGAGATCCACTTAACTCGAGTTAAGTGGATCTCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016856.2-413s21c1
Sequence:CCGGTGTGCCATCTATGCAACAATTCTCGAGAATTGTTGCATAGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-2882s1c1
Sequence:CCGGGCTCATTACTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016856.2-585s1c1
Sequence:CCGGGCAAAGGACATGGTTTGTCTACTCGAGTAGACAAACCATGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-480s1c1
Sequence:CCGGCTCGACACAATACAGAAGATTCTCGAGAATCTTCTGTATTGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016856.2-1284s1c1
Sequence:CCGGCTACTGAGAAAGTTACAGAAACTCGAGTTTCTGTAACTTTCTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016856.2-2054s1c1
Sequence:CCGGGCTTGGATAGATGGCGTCTTACTCGAGTAAGACGCCATCTATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks