EMAIL THIS PAGE TO A FRIEND

CPSF3

cleavage and polyadenylation specific factor 3, 73kDa

54 Gene Product Result for
Synonyms: CPSF-73 CPSF73
UniProtKB ID: Q9UKF6, O14769, Q53RS2, Q96F36
Gene ID:
Human(51692) Summary: This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA processing. [provided by RefSeq, Oct 2012]
Mouse(54451) cleavage and polyadenylation specificity factor 3
Rat(298916) cleavage and polyadenylation specific factor 3, 73kDa
naked mole-rat(101721287) cleavage and polyadenylation specific factor 3, 73kDa
domestic guinea pig(100732642) cleavage and polyadenylation specific factor 3, 73kDa
sheep(101116553) cleavage and polyadenylation specific factor 3, 73kDa
Domestic Rabbit(100354833) cleavage and polyadenylation specific factor 3, 73kDa
Zebrafish(324554) cleavage and polyadenylation specific factor 3
chicken(421929) cleavage and polyadenylation specific factor 3, 73kDa
dog(482962) cleavage and polyadenylation specific factor 3, 73kDa
domestic cat(101089510) cleavage and polyadenylation specific factor 3, 73kDa
cow(281712) cleavage and polyadenylation specific factor 3, 73kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016207 Rosetta Predictions human pricing
NM_001030030 Rosetta Predictions rat pricing
NM_018813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070702 predicted 1585
2 SASI_Hs01_00070703 predicted 1780
3 SASI_Hs01_00070705 predicted 1874
4 SASI_Hs01_00070706 predicted 1071
5 SASI_Hs01_00070707 predicted 849
6 SASI_Hs02_00349057 predicted 1919
7 SASI_Hs01_00070709 predicted 693
8 SASI_Hs01_00070710 predicted 865
9 SASI_Hs02_00349058 predicted 917
10 SASI_Hs02_00349059 predicted 959
11 SASI_Hs01_00070704 predicted 1035
12 SASI_Hs01_00070708 predicted 1058
13 SASI_Hs01_00070711 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071658 predicted 593
2 SASI_Rn01_00071659 predicted 664
3 SASI_Rn01_00071661 predicted 1117
4 SASI_Rn01_00071662 predicted 270
5 SASI_Rn01_00071663 predicted 1846
6 SASI_Rn01_00071664 predicted 372
7 SASI_Rn01_00071665 predicted 1095
8 SASI_Rn01_00071666 predicted 1376
9 SASI_Rn01_00071667 predicted 891
10 SASI_Rn02_00203537 predicted 1161
11 SASI_Rn01_00071660 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193041 predicted 1092
2 SASI_Mm01_00193043 predicted 880
3 SASI_Mm01_00193044 predicted 1079
4 SASI_Mm01_00193046 predicted 285
5 SASI_Mm01_00193048 predicted 1873
6 SASI_Mm01_00193049 predicted 899
7 SASI_Mm01_00193050 predicted 1794
8 SASI_Mm02_00324152 predicted 1194
9 SASI_Mm02_00324153 predicted 249
10 SASI_Mm02_00324154 predicted 1082
11 SASI_Mm01_00193042 predicted 1110
12 SASI_Mm01_00193045 predicted 610
13 SASI_Mm01_00193047 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016207
VALIDATED
CPSF3 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 3, 73kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-2097s1c1
Sequence:CCGGGCCTGTATATGAACTTTGAAACTCGAGTTTCAAAGTTCATATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-219s1c1
Sequence:CCGGGCTGAGATTGATCTCCTATTACTCGAGTAATAGGAGATCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-1240s1c1
Sequence:CCGGCCAGTGAATTTATTCGTGCTTCTCGAGAAGCACGAATAAATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016207.2-1323s1c1
Sequence:CCGGGCACTGATTCGAGAATATGAACTCGAGTTCATATTCTCGAATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-1856s1c1
Sequence:CCGGGCACGTTTACAGCAAGAGGTTCTCGAGAACCTCTTGCTGTAAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-1240s21c1
Sequence:CCGGCCAGTGAATTTATTCGTGCTTCTCGAGAAGCACGAATAAATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016207.2-2097s21c1
Sequence:CCGGGCCTGTATATGAACTTTGAAACTCGAGTTTCAAAGTTCATATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-219s21c1
Sequence:CCGGGCTGAGATTGATCTCCTATTACTCGAGTAATAGGAGATCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-1323s21c1
Sequence:CCGGGCACTGATTCGAGAATATGAACTCGAGTTCATATTCTCGAATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016207
VALIDATED
CPSF3 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 3, 73kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-2097s1c1
Sequence:CCGGGCCTGTATATGAACTTTGAAACTCGAGTTTCAAAGTTCATATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-219s1c1
Sequence:CCGGGCTGAGATTGATCTCCTATTACTCGAGTAATAGGAGATCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-1240s1c1
Sequence:CCGGCCAGTGAATTTATTCGTGCTTCTCGAGAAGCACGAATAAATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016207.2-1323s1c1
Sequence:CCGGGCACTGATTCGAGAATATGAACTCGAGTTCATATTCTCGAATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-1856s1c1
Sequence:CCGGGCACGTTTACAGCAAGAGGTTCTCGAGAACCTCTTGCTGTAAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-1240s21c1
Sequence:CCGGCCAGTGAATTTATTCGTGCTTCTCGAGAAGCACGAATAAATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016207.2-2097s21c1
Sequence:CCGGGCCTGTATATGAACTTTGAAACTCGAGTTTCAAAGTTCATATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-219s21c1
Sequence:CCGGGCTGAGATTGATCTCCTATTACTCGAGTAATAGGAGATCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-1323s21c1
Sequence:CCGGGCACTGATTCGAGAATATGAACTCGAGTTCATATTCTCGAATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016207
VALIDATED
CPSF3 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 3, 73kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-2097s1c1
Sequence:CCGGGCCTGTATATGAACTTTGAAACTCGAGTTTCAAAGTTCATATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-219s1c1
Sequence:CCGGGCTGAGATTGATCTCCTATTACTCGAGTAATAGGAGATCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-1240s1c1
Sequence:CCGGCCAGTGAATTTATTCGTGCTTCTCGAGAAGCACGAATAAATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016207.2-1323s1c1
Sequence:CCGGGCACTGATTCGAGAATATGAACTCGAGTTCATATTCTCGAATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016207.2-1856s1c1
Sequence:CCGGGCACGTTTACAGCAAGAGGTTCTCGAGAACCTCTTGCTGTAAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-1240s21c1
Sequence:CCGGCCAGTGAATTTATTCGTGCTTCTCGAGAAGCACGAATAAATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016207.2-2097s21c1
Sequence:CCGGGCCTGTATATGAACTTTGAAACTCGAGTTTCAAAGTTCATATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-219s21c1
Sequence:CCGGGCTGAGATTGATCTCCTATTACTCGAGTAATAGGAGATCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016207.2-1323s21c1
Sequence:CCGGGCACTGATTCGAGAATATGAACTCGAGTTCATATTCTCGAATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018813
VALIDATED
CPSF3 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 3, 73kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-1281s1c1
Sequence:CCGGCCAGCAAACCAGTGAATTTATCTCGAGATAAATTCACTGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-1720s1c1
Sequence:CCGGCCTGCTCTGAAGGTGTTCAAACTCGAGTTTGAACACCTTCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-735s1c1
Sequence:CCGGGCGAGAAGCAAGATTCTGCAACTCGAGTTGCAGAATCTTGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-870s1c1
Sequence:CCGGGCTGCATGACATACCCATTTACTCGAGTAAATGGGTATGTCATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-873s1c1
Sequence:CCGGGCATGACATACCCATTTACTACTCGAGTAGTAAATGGGTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-1281s21c1
Sequence:CCGGCCAGCAAACCAGTGAATTTATCTCGAGATAAATTCACTGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-735s21c1
Sequence:CCGGGCGAGAAGCAAGATTCTGCAACTCGAGTTGCAGAATCTTGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-873s21c1
Sequence:CCGGGCATGACATACCCATTTACTACTCGAGTAGTAAATGGGTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-1720s21c1
Sequence:CCGGCCTGCTCTGAAGGTGTTCAAACTCGAGTTTGAACACCTTCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018813
VALIDATED
CPSF3 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 3, 73kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-1281s1c1
Sequence:CCGGCCAGCAAACCAGTGAATTTATCTCGAGATAAATTCACTGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-1720s1c1
Sequence:CCGGCCTGCTCTGAAGGTGTTCAAACTCGAGTTTGAACACCTTCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-735s1c1
Sequence:CCGGGCGAGAAGCAAGATTCTGCAACTCGAGTTGCAGAATCTTGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-870s1c1
Sequence:CCGGGCTGCATGACATACCCATTTACTCGAGTAAATGGGTATGTCATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-873s1c1
Sequence:CCGGGCATGACATACCCATTTACTACTCGAGTAGTAAATGGGTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-1281s21c1
Sequence:CCGGCCAGCAAACCAGTGAATTTATCTCGAGATAAATTCACTGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-735s21c1
Sequence:CCGGGCGAGAAGCAAGATTCTGCAACTCGAGTTGCAGAATCTTGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-873s21c1
Sequence:CCGGGCATGACATACCCATTTACTACTCGAGTAGTAAATGGGTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-1720s21c1
Sequence:CCGGCCTGCTCTGAAGGTGTTCAAACTCGAGTTTGAACACCTTCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018813
VALIDATED
CPSF3 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 3, 73kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-1281s1c1
Sequence:CCGGCCAGCAAACCAGTGAATTTATCTCGAGATAAATTCACTGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-1720s1c1
Sequence:CCGGCCTGCTCTGAAGGTGTTCAAACTCGAGTTTGAACACCTTCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-735s1c1
Sequence:CCGGGCGAGAAGCAAGATTCTGCAACTCGAGTTGCAGAATCTTGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-870s1c1
Sequence:CCGGGCTGCATGACATACCCATTTACTCGAGTAAATGGGTATGTCATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018813.2-873s1c1
Sequence:CCGGGCATGACATACCCATTTACTACTCGAGTAGTAAATGGGTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-1281s21c1
Sequence:CCGGCCAGCAAACCAGTGAATTTATCTCGAGATAAATTCACTGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-735s21c1
Sequence:CCGGGCGAGAAGCAAGATTCTGCAACTCGAGTTGCAGAATCTTGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-873s21c1
Sequence:CCGGGCATGACATACCCATTTACTACTCGAGTAGTAAATGGGTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018813.2-1720s21c1
Sequence:CCGGCCTGCTCTGAAGGTGTTCAAACTCGAGTTTGAACACCTTCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks