EMAIL THIS PAGE TO A FRIEND

CPSF3L

cleavage and polyadenylation specific factor 3-like

68 Gene Product Result for
Synonyms: CPSF73L INT11 INTS11 RC-68 RC68
Gene ID:
Human(54973) Summary: The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]
Mouse(71957) cleavage and polyadenylation specific factor 3-like
Rat(298688) cleavage and polyadenylation specific factor 3-like
Zebrafish(553648) cleavage and polyadenylation specific factor 3-like
domestic cat(101084525) cleavage and polyadenylation specific factor 3-like
cow(522378) cleavage and polyadenylation specific factor 3-like
Horse(100065939) cleavage and polyadenylation specific factor 3-like
dog(479571) cleavage and polyadenylation specific factor 3-like
chicken(419418) cleavage and polyadenylation specific factor 3-like
sheep(101104768) cleavage and polyadenylation specific factor 3-like
domestic guinea pig(100729495) cleavage and polyadenylation specific factor 3-like
naked mole-rat(101717953) cleavage and polyadenylation specific factor 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017871 Rosetta Predictions human pricing
NM_032179 Rosetta Predictions human pricing
NM_001033892 Rosetta Predictions rat pricing
NM_028020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350804 predicted 1898
2 SASI_Hs01_00032429 predicted 221
3 SASI_Hs02_00350805 predicted 537
4 SASI_Hs01_00032430 predicted 218
5 SASI_Hs02_00350806 predicted 1092
6 SASI_Hs02_00350807 predicted 914
7 SASI_Hs02_00350808 predicted 1542
8 SASI_Hs02_00350809 predicted 1562
9 SASI_Hs02_00350810 predicted 801
10 SASI_Hs02_00350811 predicted 1063
11 SASI_Hs01_00032431 predicted 1355
12 SASI_Hs01_00032432 predicted 1218
13 SASI_Hs01_00032433 predicted 211
14 SASI_Hs01_00032434 predicted 1345
15 SASI_Hs01_00032435 predicted 1185
16 SASI_Hs01_00032436 predicted 1132
17 SASI_Hs01_00032437 predicted 1192
18 SASI_Hs01_00032438 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121811 predicted 231
2 SASI_Hs01_00121812 predicted 232
3 SASI_Hs01_00121813 predicted 1311
4 SASI_Hs01_00121814 predicted 1176
5 SASI_Hs01_00121815 predicted 227
6 SASI_Hs01_00121816 predicted 1294
7 SASI_Hs01_00121817 predicted 1148
8 SASI_Hs01_00121818 predicted 1095
9 SASI_Hs01_00121819 predicted 1146
10 SASI_Hs01_00121820 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072818 predicted 595
2 SASI_Rn01_00072819 predicted 336
3 SASI_Rn01_00072821 predicted 247
4 SASI_Rn01_00072822 predicted 1006
5 SASI_Rn01_00072823 predicted 771
6 SASI_Rn01_00072824 predicted 674
7 SASI_Rn01_00072825 predicted 563
8 SASI_Rn01_00072826 predicted 1649
9 SASI_Rn02_00203790 predicted 534
10 SASI_Rn02_00203791 predicted 743
11 SASI_Rn01_00072820 predicted 437
12 SASI_Rn01_00072827 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168855 predicted 1825
2 SASI_Mm01_00168857 predicted 1834
3 SASI_Mm01_00168858 predicted 1699
4 SASI_Mm01_00168859 predicted 491
5 SASI_Mm01_00168860 predicted 1167
6 SASI_Mm01_00168861 predicted 371
7 SASI_Mm02_00333157 predicted 1830
8 SASI_Mm01_00168862 predicted 1689
9 SASI_Mm01_00168863 predicted 1586
10 SASI_Mm01_00168864 predicted 1047
11 SASI_Mm01_00168856 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017871
VALIDATED
CPSF3L MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 3-like
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-237s21c1
Sequence:CCGGTCCTGGACTGTGTGATCATTACTCGAGTAATGATCACACAGTCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-919s21c1
Sequence:CCGGCCAGAAGATCCGCAAGACTTTCTCGAGAAAGTCTTGCGGATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-159s21c1
Sequence:CCGGGAATGCACATGGGCTTCAATGCTCGAGCATTGAAGCCCATGTGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-946s21c1
Sequence:CCGGGAGGAACATGTTTGAGTTCAACTCGAGTTGAACTCAAACATGTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-576s21c1
Sequence:CCGGTGGTCTACACGGGTGATTATACTCGAGTATAATCACCCGTGTAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-902s1c1
Sequence:CCGGCCAGAAGATCCGCAAGACTTTCTCGAGAAAGTCTTGCGGATCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-693s1c1
Sequence:CCGGGAGCGAGACTTCCTGAAGAAACTCGAGTTTCTTCAGGAAGTCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017871.3-869s1c1
Sequence:CCGGCCACTACTACAAGCTGTTCATCTCGAGATGAACAGCTTGTAGTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-1292s1c1
Sequence:CCGGCAAGAAGATGGAGTTCCTGAACTCGAGTTCAGGAACTCCATCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-926s1c1
Sequence:CCGGGCAGAGGAACATGTTTGAGTTCTCGAGAACTCAAACATGTTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-929s1c1
Sequence:CCGGGAGGAACATGTTTGAGTTCAACTCGAGTTGAACTCAAACATGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-522s1c1
Sequence:CCGGGCAGCCATGTTCCAGATTAAACTCGAGTTTAATCTGGAACATGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-410s1c1
Sequence:CCGGCCAGATGATCAAAGACTGCATCTCGAGATGCAGTCTTTGATCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-866s1c1
Sequence:CCGGCAACCACTACTACAAGCTGTTCTCGAGAACAGCTTGTAGTAGTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017871
VALIDATED
CPSF3L MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 3-like
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-237s21c1
Sequence:CCGGTCCTGGACTGTGTGATCATTACTCGAGTAATGATCACACAGTCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-919s21c1
Sequence:CCGGCCAGAAGATCCGCAAGACTTTCTCGAGAAAGTCTTGCGGATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-159s21c1
Sequence:CCGGGAATGCACATGGGCTTCAATGCTCGAGCATTGAAGCCCATGTGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-946s21c1
Sequence:CCGGGAGGAACATGTTTGAGTTCAACTCGAGTTGAACTCAAACATGTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-576s21c1
Sequence:CCGGTGGTCTACACGGGTGATTATACTCGAGTATAATCACCCGTGTAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-902s1c1
Sequence:CCGGCCAGAAGATCCGCAAGACTTTCTCGAGAAAGTCTTGCGGATCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-693s1c1
Sequence:CCGGGAGCGAGACTTCCTGAAGAAACTCGAGTTTCTTCAGGAAGTCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017871.3-869s1c1
Sequence:CCGGCCACTACTACAAGCTGTTCATCTCGAGATGAACAGCTTGTAGTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-1292s1c1
Sequence:CCGGCAAGAAGATGGAGTTCCTGAACTCGAGTTCAGGAACTCCATCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-926s1c1
Sequence:CCGGGCAGAGGAACATGTTTGAGTTCTCGAGAACTCAAACATGTTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-929s1c1
Sequence:CCGGGAGGAACATGTTTGAGTTCAACTCGAGTTGAACTCAAACATGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-522s1c1
Sequence:CCGGGCAGCCATGTTCCAGATTAAACTCGAGTTTAATCTGGAACATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-410s1c1
Sequence:CCGGCCAGATGATCAAAGACTGCATCTCGAGATGCAGTCTTTGATCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-866s1c1
Sequence:CCGGCAACCACTACTACAAGCTGTTCTCGAGAACAGCTTGTAGTAGTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017871
VALIDATED
CPSF3L MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 3-like
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-237s21c1
Sequence:CCGGTCCTGGACTGTGTGATCATTACTCGAGTAATGATCACACAGTCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-919s21c1
Sequence:CCGGCCAGAAGATCCGCAAGACTTTCTCGAGAAAGTCTTGCGGATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-159s21c1
Sequence:CCGGGAATGCACATGGGCTTCAATGCTCGAGCATTGAAGCCCATGTGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-946s21c1
Sequence:CCGGGAGGAACATGTTTGAGTTCAACTCGAGTTGAACTCAAACATGTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017871.4-576s21c1
Sequence:CCGGTGGTCTACACGGGTGATTATACTCGAGTATAATCACCCGTGTAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-902s1c1
Sequence:CCGGCCAGAAGATCCGCAAGACTTTCTCGAGAAAGTCTTGCGGATCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-693s1c1
Sequence:CCGGGAGCGAGACTTCCTGAAGAAACTCGAGTTTCTTCAGGAAGTCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017871.3-869s1c1
Sequence:CCGGCCACTACTACAAGCTGTTCATCTCGAGATGAACAGCTTGTAGTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-1292s1c1
Sequence:CCGGCAAGAAGATGGAGTTCCTGAACTCGAGTTCAGGAACTCCATCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-926s1c1
Sequence:CCGGGCAGAGGAACATGTTTGAGTTCTCGAGAACTCAAACATGTTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-929s1c1
Sequence:CCGGGAGGAACATGTTTGAGTTCAACTCGAGTTGAACTCAAACATGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-522s1c1
Sequence:CCGGGCAGCCATGTTCCAGATTAAACTCGAGTTTAATCTGGAACATGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-410s1c1
Sequence:CCGGCCAGATGATCAAAGACTGCATCTCGAGATGCAGTCTTTGATCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017871.3-866s1c1
Sequence:CCGGCAACCACTACTACAAGCTGTTCTCGAGAACAGCTTGTAGTAGTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028020
VALIDATED
CPSF3L MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 3-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-903s21c1
Sequence:CCGGGAACCTGAAGGTGCCCATATACTCGAGTATATGGGCACCTTCAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-644s21c1
Sequence:CCGGTGGTCTACACGGGTGACTATACTCGAGTATAGTCACCCGTGTAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-1839s21c1
Sequence:CCGGGCTATTGGTCTCCTGGACTTACTCGAGTAAGTCCAGGAGACCAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028020.3-568s21c1
Sequence:CCGGCTGGAAATCAAGGCATACTATCTCGAGATAGTATGCCTTGATTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-380s21c1
Sequence:CCGGGCTACGATGGACCCATCTATACTCGAGTATAGATGGGTCCATCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-2012s1c1
Sequence:CCGGCCTGAGTAAATGGGAGACCATCTCGAGATGGTCTCCCATTTACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-569s1c1
Sequence:CCGGCTGGAAATCAAGGCATACTATCTCGAGATAGTATGCCTTGATTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-381s1c1
Sequence:CCGGGCTACGATGGACCCATCTATACTCGAGTATAGATGGGTCCATCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028020.2-1840s1c1
Sequence:CCGGGCTATTGGTCTCCTGGACTTACTCGAGTAAGTCCAGGAGACCAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028020.2-608s1c1
Sequence:CCGGGCAGCCATGTTCCAGATTAAACTCGAGTTTAATCTGGAACATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028020
VALIDATED
CPSF3L MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 3-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-903s21c1
Sequence:CCGGGAACCTGAAGGTGCCCATATACTCGAGTATATGGGCACCTTCAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-644s21c1
Sequence:CCGGTGGTCTACACGGGTGACTATACTCGAGTATAGTCACCCGTGTAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-1839s21c1
Sequence:CCGGGCTATTGGTCTCCTGGACTTACTCGAGTAAGTCCAGGAGACCAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028020.3-568s21c1
Sequence:CCGGCTGGAAATCAAGGCATACTATCTCGAGATAGTATGCCTTGATTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-380s21c1
Sequence:CCGGGCTACGATGGACCCATCTATACTCGAGTATAGATGGGTCCATCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-2012s1c1
Sequence:CCGGCCTGAGTAAATGGGAGACCATCTCGAGATGGTCTCCCATTTACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-569s1c1
Sequence:CCGGCTGGAAATCAAGGCATACTATCTCGAGATAGTATGCCTTGATTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-381s1c1
Sequence:CCGGGCTACGATGGACCCATCTATACTCGAGTATAGATGGGTCCATCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028020.2-1840s1c1
Sequence:CCGGGCTATTGGTCTCCTGGACTTACTCGAGTAAGTCCAGGAGACCAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028020.2-608s1c1
Sequence:CCGGGCAGCCATGTTCCAGATTAAACTCGAGTTTAATCTGGAACATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028020
VALIDATED
CPSF3L MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 3-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-903s21c1
Sequence:CCGGGAACCTGAAGGTGCCCATATACTCGAGTATATGGGCACCTTCAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-644s21c1
Sequence:CCGGTGGTCTACACGGGTGACTATACTCGAGTATAGTCACCCGTGTAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-1839s21c1
Sequence:CCGGGCTATTGGTCTCCTGGACTTACTCGAGTAAGTCCAGGAGACCAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028020.3-568s21c1
Sequence:CCGGCTGGAAATCAAGGCATACTATCTCGAGATAGTATGCCTTGATTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028020.3-380s21c1
Sequence:CCGGGCTACGATGGACCCATCTATACTCGAGTATAGATGGGTCCATCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-2012s1c1
Sequence:CCGGCCTGAGTAAATGGGAGACCATCTCGAGATGGTCTCCCATTTACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-569s1c1
Sequence:CCGGCTGGAAATCAAGGCATACTATCTCGAGATAGTATGCCTTGATTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028020.2-381s1c1
Sequence:CCGGGCTACGATGGACCCATCTATACTCGAGTATAGATGGGTCCATCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028020.2-1840s1c1
Sequence:CCGGGCTATTGGTCTCCTGGACTTACTCGAGTAAGTCCAGGAGACCAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028020.2-608s1c1
Sequence:CCGGGCAGCCATGTTCCAGATTAAACTCGAGTTTAATCTGGAACATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)