EMAIL THIS PAGE TO A FRIEND

CPSF4

cleavage and polyadenylation specific factor 4, 30kDa

68 Gene Product Result for
Synonyms: CPSF30 NAR NEB1
UniProtKB ID: O95639, D6W5S8, Q6FGE6, Q86TF8, Q9BTW6
Gene ID:
Human(10898) Summary: Inhibition of the nuclear export of poly(A)-containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(54188) cleavage and polyadenylation specific factor 4
Rat(304277) cleavage and polyadenylation specific factor 4
naked mole-rat(101698559) cleavage and polyadenylation specific factor 4, 30kDa
domestic guinea pig(100722077) cleavage and polyadenylation specific factor 4, 30kDa
Zebrafish(30203) cleavage and polyadenylation specific factor 4
cow(280875) cleavage and polyadenylation specific factor 4, 30kDa
domestic cat(101085423) cleavage and polyadenylation specific factor 4, 30kDa
dog(489859) cleavage and polyadenylation specific factor 4, 30kDa
chicken(416494) cleavage and polyadenylation specific factor 4, 30kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081559 Rosetta Predictions human pricing
NM_006693 Rosetta Predictions human pricing
NM_001012351 Rosetta Predictions rat pricing
NM_178576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316423 predicted 1325
2 SASI_Hs02_00316424 predicted 1328
3 SASI_Hs02_00316425 predicted 1006
4 SASI_Hs02_00316426 predicted 386
5 SASI_Hs02_00316427 predicted 976
6 SASI_Hs02_00316428 predicted 1009
7 SASI_Hs02_00316429 predicted 908
8 SASI_Hs02_00316430 predicted 446
9 SASI_Hs02_00316431 predicted 851
10 SASI_Hs02_00316432 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342106 predicted 1397
2 SASI_Hs02_00342107 predicted 1403
3 SASI_Hs01_00101910 predicted 1085
4 SASI_Hs02_00342108 predicted 387
5 SASI_Hs01_00101912 predicted 985
6 SASI_Hs01_00101913 predicted 990
7 SASI_Hs01_00101915 predicted 981
8 SASI_Hs02_00342109 predicted 1050
9 SASI_Hs01_00101916 predicted 1089
10 SASI_Hs02_00342110 predicted 1018
11 SASI_Hs01_00101907 predicted 342
12 SASI_Hs01_00101908 predicted 888
13 SASI_Hs01_00101909 predicted 829
14 SASI_Hs01_00101911 predicted 821
15 SASI_Hs01_00101914 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045701 predicted 925
2 SASI_Rn01_00045702 predicted 1253
3 SASI_Rn01_00045703 predicted 1271
4 SASI_Rn01_00045704 predicted 875
5 SASI_Rn01_00045706 predicted 854
6 SASI_Rn01_00045707 predicted 869
7 SASI_Rn02_00200531 predicted 1029
8 SASI_Rn01_00045700 predicted 350
9 SASI_Rn02_00200532 predicted 250
10 SASI_Rn01_00045705 predicted 545
11 SASI_Rn01_00045708 predicted 869
12 SASI_Rn01_00045709 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058713 predicted 338
2 SASI_Mm01_00058705 predicted 287
3 SASI_Mm01_00058706 predicted 400
4 SASI_Mm02_00348899 predicted 372
5 SASI_Mm01_00058708 predicted 467
6 SASI_Mm01_00058709 predicted 524
7 SASI_Mm01_00058710 predicted 398
8 SASI_Mm01_00058711 predicted 300
9 SASI_Mm01_00058707 predicted 510
10 SASI_Mm01_00058714 predicted 145
11 SASI_Mm01_00058712 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178576
VALIDATED
CPSF4 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 4, 30kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-916s1c1
Sequence:CCGGGCCATGTCTGTCCTTTCATTTCTCGAGAAATGAAAGGACAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-467s1c1
Sequence:CCGGCCGGAGAGTCATTTGTGTGAACTCGAGTTCACACAAATGACTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-377s1c1
Sequence:CCGGGTGTGAGTTCTTGCATGAATACTCGAGTATTCATGCAAGAACTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178576.1-536s1c1
Sequence:CCGGCCCTCGATTTGAACTGCCCATCTCGAGATGGGCAGTTCAAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-728s1c1
Sequence:CCGGCAGATGCACCAAAGGGCATTTCTCGAGAAATGCCCTTTGGTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178576.2-376s21c1
Sequence:CCGGGTGTGAGTTCTTGCATGAATACTCGAGTATTCATGCAAGAACTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178576.2-915s21c1
Sequence:CCGGGCCATGTCTGTCCTTTCATTTCTCGAGAAATGAAAGGACAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-348s21c1
Sequence:CCGGTGAGAGGACTGTGCAAGAAAGCTCGAGCTTTCTTGCACAGTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-506s21c1
Sequence:CCGGCCTGAGGGACCATCATGTAAACTCGAGTTTACATGATGGTCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-693s21c1
Sequence:CCGGGCTACAAGTGTGGTGAGAAAGCTCGAGCTTTCTCACCACACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178576
VALIDATED
CPSF4 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 4, 30kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-916s1c1
Sequence:CCGGGCCATGTCTGTCCTTTCATTTCTCGAGAAATGAAAGGACAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-467s1c1
Sequence:CCGGCCGGAGAGTCATTTGTGTGAACTCGAGTTCACACAAATGACTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-377s1c1
Sequence:CCGGGTGTGAGTTCTTGCATGAATACTCGAGTATTCATGCAAGAACTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178576.1-536s1c1
Sequence:CCGGCCCTCGATTTGAACTGCCCATCTCGAGATGGGCAGTTCAAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-728s1c1
Sequence:CCGGCAGATGCACCAAAGGGCATTTCTCGAGAAATGCCCTTTGGTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178576.2-376s21c1
Sequence:CCGGGTGTGAGTTCTTGCATGAATACTCGAGTATTCATGCAAGAACTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178576.2-915s21c1
Sequence:CCGGGCCATGTCTGTCCTTTCATTTCTCGAGAAATGAAAGGACAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-348s21c1
Sequence:CCGGTGAGAGGACTGTGCAAGAAAGCTCGAGCTTTCTTGCACAGTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-506s21c1
Sequence:CCGGCCTGAGGGACCATCATGTAAACTCGAGTTTACATGATGGTCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-693s21c1
Sequence:CCGGGCTACAAGTGTGGTGAGAAAGCTCGAGCTTTCTCACCACACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178576
VALIDATED
CPSF4 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 4, 30kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-916s1c1
Sequence:CCGGGCCATGTCTGTCCTTTCATTTCTCGAGAAATGAAAGGACAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-467s1c1
Sequence:CCGGCCGGAGAGTCATTTGTGTGAACTCGAGTTCACACAAATGACTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-377s1c1
Sequence:CCGGGTGTGAGTTCTTGCATGAATACTCGAGTATTCATGCAAGAACTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178576.1-536s1c1
Sequence:CCGGCCCTCGATTTGAACTGCCCATCTCGAGATGGGCAGTTCAAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178576.1-728s1c1
Sequence:CCGGCAGATGCACCAAAGGGCATTTCTCGAGAAATGCCCTTTGGTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178576.2-376s21c1
Sequence:CCGGGTGTGAGTTCTTGCATGAATACTCGAGTATTCATGCAAGAACTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178576.2-915s21c1
Sequence:CCGGGCCATGTCTGTCCTTTCATTTCTCGAGAAATGAAAGGACAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-348s21c1
Sequence:CCGGTGAGAGGACTGTGCAAGAAAGCTCGAGCTTTCTTGCACAGTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-506s21c1
Sequence:CCGGCCTGAGGGACCATCATGTAAACTCGAGTTTACATGATGGTCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178576.2-693s21c1
Sequence:CCGGGCTACAAGTGTGGTGAGAAAGCTCGAGCTTTCTCACCACACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006693
VALIDATED
CPSF4 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 4, 30kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006693.1-985s1c1
Sequence:CCGGCGTCTGTTAGTTTCCTATCATCTCGAGATGATAGGAAACTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-768s1c1
Sequence:CCGGCTGTTACAAGTGTGGCGAGAACTCGAGTTCTCGCCACACTTGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-607s1c1
Sequence:CCGGCAAAGTAACAATCCGCCATTACTCGAGTAATGGCGGATTGTTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-606s1c1
Sequence:CCGGGCAAAGTAACAATCCGCCATTCTCGAGAATGGCGGATTGTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-291s1c1
Sequence:CCGGGCATGAGTATGACATGACCAACTCGAGTTGGTCATGTCATACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006693.2-576s21c1
Sequence:CCGGAGAGTCATCTGTGTGAATTACCTCGAGGTAATTCACACAGATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006693.2-904s21c1
Sequence:CCGGACGCCAACAGATGCACCAAAGCTCGAGCTTTGGTGCATCTGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006693.2-742s21c1
Sequence:CCGGCGTCCTCCTTGATCCAGTTAACTCGAGTTAACTGGATCAAGGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006693.2-1092s21c1
Sequence:CCGGCGTCTGTTAGTTTCCTATCATCTCGAGATGATAGGAAACTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006693
VALIDATED
CPSF4 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 4, 30kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006693.1-985s1c1
Sequence:CCGGCGTCTGTTAGTTTCCTATCATCTCGAGATGATAGGAAACTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-768s1c1
Sequence:CCGGCTGTTACAAGTGTGGCGAGAACTCGAGTTCTCGCCACACTTGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-607s1c1
Sequence:CCGGCAAAGTAACAATCCGCCATTACTCGAGTAATGGCGGATTGTTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-606s1c1
Sequence:CCGGGCAAAGTAACAATCCGCCATTCTCGAGAATGGCGGATTGTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-291s1c1
Sequence:CCGGGCATGAGTATGACATGACCAACTCGAGTTGGTCATGTCATACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006693.2-576s21c1
Sequence:CCGGAGAGTCATCTGTGTGAATTACCTCGAGGTAATTCACACAGATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006693.2-904s21c1
Sequence:CCGGACGCCAACAGATGCACCAAAGCTCGAGCTTTGGTGCATCTGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006693.2-742s21c1
Sequence:CCGGCGTCCTCCTTGATCCAGTTAACTCGAGTTAACTGGATCAAGGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006693.2-1092s21c1
Sequence:CCGGCGTCTGTTAGTTTCCTATCATCTCGAGATGATAGGAAACTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006693
VALIDATED
CPSF4 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 4, 30kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006693.1-985s1c1
Sequence:CCGGCGTCTGTTAGTTTCCTATCATCTCGAGATGATAGGAAACTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-768s1c1
Sequence:CCGGCTGTTACAAGTGTGGCGAGAACTCGAGTTCTCGCCACACTTGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-607s1c1
Sequence:CCGGCAAAGTAACAATCCGCCATTACTCGAGTAATGGCGGATTGTTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-606s1c1
Sequence:CCGGGCAAAGTAACAATCCGCCATTCTCGAGAATGGCGGATTGTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006693.1-291s1c1
Sequence:CCGGGCATGAGTATGACATGACCAACTCGAGTTGGTCATGTCATACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006693.2-576s21c1
Sequence:CCGGAGAGTCATCTGTGTGAATTACCTCGAGGTAATTCACACAGATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006693.2-904s21c1
Sequence:CCGGACGCCAACAGATGCACCAAAGCTCGAGCTTTGGTGCATCTGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006693.2-742s21c1
Sequence:CCGGCGTCCTCCTTGATCCAGTTAACTCGAGTTAACTGGATCAAGGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006693.2-1092s21c1
Sequence:CCGGCGTCTGTTAGTTTCCTATCATCTCGAGATGATAGGAAACTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks