EMAIL THIS PAGE TO A FRIEND

CPSF4L

cleavage and polyadenylation specific factor 4-like

87 Gene Product Result for
UniProtKB ID: A6NMK7, A8MU95, B2RXI9
Gene ID:
Mouse(52670) cleavage and polyadenylation specific factor 4-like
Rat(287799) cleavage and polyadenylation specific factor 4-like
chicken(771558) cleavage and polyadenylation specific factor 4-like
dog(100687401) cleavage and polyadenylation specific factor 4-like
cow(790056) cleavage and polyadenylation specific factor 4-like
domestic cat(101092311) cleavage and polyadenylation specific factor 4-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001129885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718139 Rosetta Predictions human pricing
XM_926241 Rosetta Predictions human pricing
XM_940633 Rosetta Predictions human pricing
XM_001081632 Rosetta Predictions rat pricing
XM_221075 Rosetta Predictions rat pricing
NM_026682 Rosetta Predictions mouse pricing
NM_029794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00421857 predicted 269
2 SASI_Hs02_00421858 predicted 250
3 SASI_Hs02_00421859 predicted 326
4 SASI_Hs02_00421860 predicted 243
5 SASI_Hs02_00421861 predicted 242
6 SASI_Hs02_00421862 predicted 219
7 SASI_Hs02_00421863 predicted 332
8 SASI_Hs02_00421864 predicted 273
9 SASI_Hs02_00421865 predicted 211
10 SASI_Hs02_00421866 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273465 predicted 240
2 SASI_Hs02_00480333 predicted 35
3 SASI_Hs01_00273467 predicted 364
4 SASI_Hs01_00273468 predicted 318
5 SASI_Hs02_00480334 predicted 27
6 SASI_Hs01_00273471 predicted 179
7 SASI_Hs02_00480335 predicted 25
8 SASI_Hs01_00273472 predicted 265
9 SASI_Hs02_00480336 predicted 12
10 SASI_Hs02_00480337 predicted 45
11 SASI_Hs01_00273464 predicted 563
12 SASI_Hs01_00273466 predicted 519
13 SASI_Hs01_00273469 predicted 447
14 SASI_Hs01_00273470 predicted 553
15 SASI_Hs01_00273473 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484339 predicted 270
2 SASI_Hs02_00484340 predicted 254
3 SASI_Hs02_00484341 predicted 322
4 SASI_Hs02_00484342 predicted 246
5 SASI_Hs02_00484343 predicted 248
6 SASI_Hs02_00484344 predicted 224
7 SASI_Hs02_00484345 predicted 329
8 SASI_Hs02_00484346 predicted 268
9 SASI_Hs02_00484347 predicted 214
10 SASI_Hs02_00484348 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372756 predicted 424
2 SASI_Rn02_00372757 predicted 377
3 SASI_Rn02_00372758 predicted 241
4 SASI_Rn02_00372759 predicted 278
5 SASI_Rn02_00372760 predicted 443
6 SASI_Rn02_00372761 predicted 227
7 SASI_Rn02_00372762 predicted 211
8 SASI_Rn02_00372763 predicted 366
9 SASI_Rn02_00372764 predicted 285
10 SASI_Rn02_00372765 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379794 predicted 416
2 SASI_Rn02_00379795 predicted 377
3 SASI_Rn02_00379796 predicted 238
4 SASI_Rn02_00379797 predicted 277
5 SASI_Rn02_00379798 predicted 442
6 SASI_Rn02_00379799 predicted 233
7 SASI_Rn02_00379800 predicted 212
8 SASI_Rn02_00379801 predicted 369
9 SASI_Rn02_00379802 predicted 292
10 SASI_Rn02_00379803 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160528 predicted 772
2 SASI_Mm01_00160529 predicted 972
3 SASI_Mm01_00160530 predicted 898
4 SASI_Mm01_00160531 predicted 932
5 SASI_Mm01_00160532 predicted 843
6 SASI_Mm02_00330718 predicted 850
7 SASI_Mm01_00160533 predicted 773
8 SASI_Mm01_00160534 predicted 774
9 SASI_Mm01_00160535 predicted 951
10 SASI_Mm01_00160536 predicted 892
11 SASI_Mm01_00160537 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064838 predicted 801
2 SASI_Mm01_00064839 predicted 986
3 SASI_Mm01_00064840 predicted 921
4 SASI_Mm01_00064841 predicted 946
5 SASI_Mm01_00064842 predicted 867
6 SASI_Mm02_00335938 predicted 877
7 SASI_Mm01_00064843 predicted 796
8 SASI_Mm01_00064844 predicted 800
9 SASI_Mm01_00064845 predicted 976
10 SASI_Mm01_00064846 predicted 915
11 SASI_Mm01_00064847 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029794
CPSF4L MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 4-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-366s21c1
Sequence:CCGGCAAGATGCCCGTGTGCTATTTCTCGAGAAATAGCACACGGGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-531s21c1
Sequence:CCGGAGTACTGTGTCCCAACTACTTCTCGAGAAGTAGTTGGGACACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-742s21c1
Sequence:CCGGCCACCATGCCAGCAAAGTAAGCTCGAGCTTACTTTGCTGGCATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029794.1-953s21c1
Sequence:CCGGTGCCCGAGATGCCAATCATACCTCGAGGTATGATTGGCATCTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-339s21c1
Sequence:CCGGCGACTTCCTGCACCAGTATGACTCGAGTCATACTGGTGCAGGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-504s1c1
Sequence:CCGGCCTGTGTAAATACCGCCATGTCTCGAGACATGGCGGTATTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-753s1c1
Sequence:CCGGGCAAAGTAAGCTGTACCCGTTCTCGAGAACGGGTACAGCTTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-375s1c1
Sequence:CCGGCGTGTGCTATTTCCACTCCAACTCGAGTTGGAGTGGAAATAGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029794
CPSF4L MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 4-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-366s21c1
Sequence:CCGGCAAGATGCCCGTGTGCTATTTCTCGAGAAATAGCACACGGGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-531s21c1
Sequence:CCGGAGTACTGTGTCCCAACTACTTCTCGAGAAGTAGTTGGGACACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-742s21c1
Sequence:CCGGCCACCATGCCAGCAAAGTAAGCTCGAGCTTACTTTGCTGGCATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029794.1-953s21c1
Sequence:CCGGTGCCCGAGATGCCAATCATACCTCGAGGTATGATTGGCATCTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-339s21c1
Sequence:CCGGCGACTTCCTGCACCAGTATGACTCGAGTCATACTGGTGCAGGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-504s1c1
Sequence:CCGGCCTGTGTAAATACCGCCATGTCTCGAGACATGGCGGTATTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-753s1c1
Sequence:CCGGGCAAAGTAAGCTGTACCCGTTCTCGAGAACGGGTACAGCTTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-375s1c1
Sequence:CCGGCGTGTGCTATTTCCACTCCAACTCGAGTTGGAGTGGAAATAGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029794
CPSF4L MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 4-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-366s21c1
Sequence:CCGGCAAGATGCCCGTGTGCTATTTCTCGAGAAATAGCACACGGGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-531s21c1
Sequence:CCGGAGTACTGTGTCCCAACTACTTCTCGAGAAGTAGTTGGGACACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-742s21c1
Sequence:CCGGCCACCATGCCAGCAAAGTAAGCTCGAGCTTACTTTGCTGGCATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029794.1-953s21c1
Sequence:CCGGTGCCCGAGATGCCAATCATACCTCGAGGTATGATTGGCATCTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029794.1-339s21c1
Sequence:CCGGCGACTTCCTGCACCAGTATGACTCGAGTCATACTGGTGCAGGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-504s1c1
Sequence:CCGGCCTGTGTAAATACCGCCATGTCTCGAGACATGGCGGTATTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-753s1c1
Sequence:CCGGGCAAAGTAAGCTGTACCCGTTCTCGAGAACGGGTACAGCTTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029794.1-375s1c1
Sequence:CCGGCGTGTGCTATTTCCACTCCAACTCGAGTTGGAGTGGAAATAGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129885
CPSF4L MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 4-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-365s21c1
Sequence:CCGGGTTTGGTGACTGCAGCAACAACTCGAGTTGTTGCTGCAGTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-180s21c1
Sequence:CCGGGTGTGCAACTTCTTCACTAAACTCGAGTTTAGTGAAGAAGTTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-461s21c1
Sequence:CCGGGGACGGTCCTCTGTGTAAATACTCGAGTATTTACACAGAGGACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-285s21c1
Sequence:CCGGCTCTGCAAGAAGGGTGATCACCTCGAGGTGATCACCCTTCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-104s21c1
Sequence:CCGGCTTCGAGAAGGATGTCGAGATCTCGAGATCTCGACATCCTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129885
CPSF4L MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 4-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-365s21c1
Sequence:CCGGGTTTGGTGACTGCAGCAACAACTCGAGTTGTTGCTGCAGTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-180s21c1
Sequence:CCGGGTGTGCAACTTCTTCACTAAACTCGAGTTTAGTGAAGAAGTTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-461s21c1
Sequence:CCGGGGACGGTCCTCTGTGTAAATACTCGAGTATTTACACAGAGGACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-285s21c1
Sequence:CCGGCTCTGCAAGAAGGGTGATCACCTCGAGGTGATCACCCTTCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-104s21c1
Sequence:CCGGCTTCGAGAAGGATGTCGAGATCTCGAGATCTCGACATCCTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129885
CPSF4L MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 4-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-365s21c1
Sequence:CCGGGTTTGGTGACTGCAGCAACAACTCGAGTTGTTGCTGCAGTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-180s21c1
Sequence:CCGGGTGTGCAACTTCTTCACTAAACTCGAGTTTAGTGAAGAAGTTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-461s21c1
Sequence:CCGGGGACGGTCCTCTGTGTAAATACTCGAGTATTTACACAGAGGACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-285s21c1
Sequence:CCGGCTCTGCAAGAAGGGTGATCACCTCGAGGTGATCACCCTTCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129885.1-104s21c1
Sequence:CCGGCTTCGAGAAGGATGTCGAGATCTCGAGATCTCGACATCCTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks