EMAIL THIS PAGE TO A FRIEND

CPSF6

cleavage and polyadenylation specific factor 6, 68kDa

Synonyms: CFIM CFIM68 HPBRII-4 HPBRII-7
UniProtKB ID: Q16630, A8K7K9, Q53ES1, Q9BSJ7, Q9BW18
Gene ID:
Human(11052) Summary: The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]
Mouse(432508) cleavage and polyadenylation specific factor 6
Rat(299811) cleavage and polyadenylation specific factor 6, 68kDa
Zebrafish(327069) cleavage and polyadenylation specific factor 6
cow(768231) cleavage and polyadenylation specific factor 6, 68kDa
chicken(417844) cleavage and polyadenylation specific factor 6, 68kDa
dog(474441) cleavage and polyadenylation specific factor 6, 68kDa
domestic guinea pig(100732506) cleavage and polyadenylation specific factor 6, 68kDa
naked mole-rat(101723861) cleavage and polyadenylation specific factor 6, 68kDa
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007007 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007007 Rosetta Predictions human pricing
NM_001106785 Rosetta Predictions rat pricing
NM_001013391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227954 predicted 1451
2 SASI_Hs01_00227955 predicted 1571
3 SASI_Hs01_00227956 predicted 1854
4 SASI_Hs01_00227957 predicted 1432
5 SASI_Hs01_00227958 predicted 1448
6 SASI_Hs01_00227959 predicted 332
7 SASI_Hs01_00227960 predicted 382
8 SASI_Hs01_00227961 predicted 1832
9 SASI_Hs02_00342763 predicted 1433
10 SASI_Hs01_00227962 predicted 1626
11 SASI_Hs01_00227963 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222378 predicted 263
2 SASI_Rn02_00222379 predicted 1373
3 SASI_Rn02_00222380 predicted 1358
4 SASI_Rn02_00222381 predicted 402
5 SASI_Rn02_00222382 predicted 305
6 SASI_Rn02_00222383 predicted 1347
7 SASI_Rn02_00222384 predicted 1268
8 SASI_Rn02_00222385 predicted 322
9 SASI_Rn02_00222386 predicted 1097
10 SASI_Rn02_00222387 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043691 predicted 318
2 SASI_Mm01_00043693 predicted 1316
3 SASI_Mm01_00043694 predicted 420
4 SASI_Mm02_00287222 predicted 1382
5 SASI_Mm01_00043695 predicted 1364
6 SASI_Mm01_00043696 predicted 1281
7 SASI_Mm01_00043697 predicted 336
8 SASI_Mm02_00287223 predicted 279
9 SASI_Mm01_00043698 predicted 347
10 SASI_Mm01_00043699 predicted 1108
11 SASI_Mm01_00043692 predicted 548
12 SASI_Mm01_00043700 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013391
VALIDATED
CPSF6 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 6, 68kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013391.1-166s1c1
Sequence:CCGGCCATCTGCAAATAATGGCGATCTCGAGATCGCCATTATTTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013391.1-350s1c1
Sequence:CCGGCCGTTCATTCTTTGGGAGTAACTCGAGTTACTCCCAAAGAATGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013391.1-511s1c1
Sequence:CCGGCCTGTTGTAACTCCATGCAATCTCGAGATTGCATGGAGTTACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013391.1-2705s1c1
Sequence:CCGGGCGTAAAGAAAGCTCTAGTATCTCGAGATACTAGAGCTTTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-290s1c1
Sequence:CCGGGAATCGCATTGTATATTGGAACTCGAGTTCCAATATACAATGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013391.1-1514s1c1
Sequence:CCGGGATCCAGACGTGAACGATCAACTCGAGTTGATCGTTCACGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-1318s1c1
Sequence:CCGGGCAATCTCAAGCAGTGCTATTCTCGAGAATAGCACTGCTTGAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013391.1-1956s1c1
Sequence:CCGGGCAACTTTATTACTGGTTATACTCGAGTATAACCAGTAATAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-1366s1c1
Sequence:CCGGGGTGATTATGGGAGTGCTATTCTCGAGAATAGCACTCCCATAATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013391
VALIDATED
CPSF6 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 6, 68kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013391.1-166s1c1
Sequence:CCGGCCATCTGCAAATAATGGCGATCTCGAGATCGCCATTATTTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013391.1-350s1c1
Sequence:CCGGCCGTTCATTCTTTGGGAGTAACTCGAGTTACTCCCAAAGAATGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013391.1-511s1c1
Sequence:CCGGCCTGTTGTAACTCCATGCAATCTCGAGATTGCATGGAGTTACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013391.1-2705s1c1
Sequence:CCGGGCGTAAAGAAAGCTCTAGTATCTCGAGATACTAGAGCTTTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-290s1c1
Sequence:CCGGGAATCGCATTGTATATTGGAACTCGAGTTCCAATATACAATGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013391.1-1514s1c1
Sequence:CCGGGATCCAGACGTGAACGATCAACTCGAGTTGATCGTTCACGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-1318s1c1
Sequence:CCGGGCAATCTCAAGCAGTGCTATTCTCGAGAATAGCACTGCTTGAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013391.1-1956s1c1
Sequence:CCGGGCAACTTTATTACTGGTTATACTCGAGTATAACCAGTAATAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-1366s1c1
Sequence:CCGGGGTGATTATGGGAGTGCTATTCTCGAGAATAGCACTCCCATAATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013391
VALIDATED
CPSF6 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 6, 68kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013391.1-166s1c1
Sequence:CCGGCCATCTGCAAATAATGGCGATCTCGAGATCGCCATTATTTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013391.1-350s1c1
Sequence:CCGGCCGTTCATTCTTTGGGAGTAACTCGAGTTACTCCCAAAGAATGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013391.1-511s1c1
Sequence:CCGGCCTGTTGTAACTCCATGCAATCTCGAGATTGCATGGAGTTACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013391.1-2705s1c1
Sequence:CCGGGCGTAAAGAAAGCTCTAGTATCTCGAGATACTAGAGCTTTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-290s1c1
Sequence:CCGGGAATCGCATTGTATATTGGAACTCGAGTTCCAATATACAATGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013391.1-1514s1c1
Sequence:CCGGGATCCAGACGTGAACGATCAACTCGAGTTGATCGTTCACGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-1318s1c1
Sequence:CCGGGCAATCTCAAGCAGTGCTATTCTCGAGAATAGCACTGCTTGAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013391.1-1956s1c1
Sequence:CCGGGCAACTTTATTACTGGTTATACTCGAGTATAACCAGTAATAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013391.1-1366s1c1
Sequence:CCGGGGTGATTATGGGAGTGCTATTCTCGAGAATAGCACTCCCATAATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007007
VALIDATED
CPSF6 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 6, 68kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007007.x-2697s1c1
Sequence:CCGGGCAGCAGGTAAATGTGAGTAACTCGAGTTACTCACATTTACCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-1374s1c1
Sequence:CCGGCACTGGTAACTGCAATTTCTTCTCGAGAAGAAATTGCAGTTACCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007007.x-1527s1c1
Sequence:CCGGACCATAGTAGATCACGAGAAACTCGAGTTTCTCGTGATCTACTATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-291s1c1
Sequence:CCGGGAAATCTAACATGGTGGACAACTCGAGTTGTCCACCATGTTAGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-1347s1c1
Sequence:CCGGCTGGTGATTATGGGAGTGCTACTCGAGTAGCACTCCCATAATCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007007.2-1425s21c1
Sequence:CCGGGGTGATTATGGGAGTGCTATTCTCGAGAATAGCACTCCCATAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007007.2-573s21c1
Sequence:CCGGGTTGTAACTCCATGCAATAAACTCGAGTTTATTGCATGGAGTTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007007.2-2411s21c1
Sequence:CCGGTAGGTGATTACATGGATATTTCTCGAGAAATATCCATGTAATCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007007.2-1652s21c1
Sequence:CCGGAGACCGTCATGACGATTATTACTCGAGTAATAATCGTCATGACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007007.2-1501s21c1
Sequence:CCGGATCGTTGCAAAGTTCTTATTACTCGAGTAATAAGAACTTTGCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007007
VALIDATED
CPSF6 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 6, 68kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007007.x-2697s1c1
Sequence:CCGGGCAGCAGGTAAATGTGAGTAACTCGAGTTACTCACATTTACCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-1374s1c1
Sequence:CCGGCACTGGTAACTGCAATTTCTTCTCGAGAAGAAATTGCAGTTACCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007007.x-1527s1c1
Sequence:CCGGACCATAGTAGATCACGAGAAACTCGAGTTTCTCGTGATCTACTATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-291s1c1
Sequence:CCGGGAAATCTAACATGGTGGACAACTCGAGTTGTCCACCATGTTAGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-1347s1c1
Sequence:CCGGCTGGTGATTATGGGAGTGCTACTCGAGTAGCACTCCCATAATCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007007.2-1425s21c1
Sequence:CCGGGGTGATTATGGGAGTGCTATTCTCGAGAATAGCACTCCCATAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007007.2-573s21c1
Sequence:CCGGGTTGTAACTCCATGCAATAAACTCGAGTTTATTGCATGGAGTTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007007.2-2411s21c1
Sequence:CCGGTAGGTGATTACATGGATATTTCTCGAGAAATATCCATGTAATCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007007.2-1652s21c1
Sequence:CCGGAGACCGTCATGACGATTATTACTCGAGTAATAATCGTCATGACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007007.2-1501s21c1
Sequence:CCGGATCGTTGCAAAGTTCTTATTACTCGAGTAATAAGAACTTTGCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007007
VALIDATED
CPSF6 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 6, 68kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007007.x-2697s1c1
Sequence:CCGGGCAGCAGGTAAATGTGAGTAACTCGAGTTACTCACATTTACCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-1374s1c1
Sequence:CCGGCACTGGTAACTGCAATTTCTTCTCGAGAAGAAATTGCAGTTACCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007007.x-1527s1c1
Sequence:CCGGACCATAGTAGATCACGAGAAACTCGAGTTTCTCGTGATCTACTATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-291s1c1
Sequence:CCGGGAAATCTAACATGGTGGACAACTCGAGTTGTCCACCATGTTAGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007007.x-1347s1c1
Sequence:CCGGCTGGTGATTATGGGAGTGCTACTCGAGTAGCACTCCCATAATCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007007.2-1425s21c1
Sequence:CCGGGGTGATTATGGGAGTGCTATTCTCGAGAATAGCACTCCCATAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007007.2-573s21c1
Sequence:CCGGGTTGTAACTCCATGCAATAAACTCGAGTTTATTGCATGGAGTTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007007.2-2411s21c1
Sequence:CCGGTAGGTGATTACATGGATATTTCTCGAGAAATATCCATGTAATCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007007.2-1652s21c1
Sequence:CCGGAGACCGTCATGACGATTATTACTCGAGTAATAATCGTCATGACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007007.2-1501s21c1
Sequence:CCGGATCGTTGCAAAGTTCTTATTACTCGAGTAATAAGAACTTTGCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks