EMAIL THIS PAGE TO A FRIEND

CPSF7

cleavage and polyadenylation specific factor 7, 59kDa

48 Gene Product Result for
Synonyms: CFIm59
UniProtKB ID: Q8N684, B3KU04, C9K0Q4, Q7Z3H9, Q9H025, Q9H9V1
Gene ID:
Mouse(269061) cleavage and polyadenylation specific factor 7
Rat(365407) cleavage and polyadenylation specific factor 7
sheep(101107398) cleavage and polyadenylation specific factor 7, 59kDa
naked mole-rat(101706514) cleavage and polyadenylation specific factor 7, 59kDa
domestic guinea pig(100723902) cleavage and polyadenylation specific factor 7, 59kDa
chicken(426014) cleavage and polyadenylation specific factor 7, 59kDa
cow(504925) cleavage and polyadenylation specific factor 7, 59kDa
Horse(100059747) cleavage and polyadenylation specific factor 7, 59kDa
domestic cat(101082092) cleavage and polyadenylation specific factor 7, 59kDa
dog(476066) cleavage and polyadenylation specific factor 7, 59kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024811 Rosetta Predictions human pricing
NM_001014245 Rosetta Predictions rat pricing
NM_172302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243225 predicted 1131
2 SASI_Hs02_00357359 predicted 720
3 SASI_Hs01_00243226 predicted 533
4 SASI_Hs01_00243227 predicted 237
5 SASI_Hs01_00243228 predicted 1194
6 SASI_Hs01_00243229 predicted 532
7 SASI_Hs01_00243231 predicted 403
8 SASI_Hs01_00243233 predicted 1095
9 SASI_Hs01_00243234 predicted 416
10 SASI_Hs02_00357360 predicted 1436
11 SASI_Hs01_00243230 predicted 435
12 SASI_Hs01_00243232 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115063 predicted 1550
2 SASI_Rn01_00115064 predicted 254
3 SASI_Rn01_00115065 predicted 306
4 SASI_Rn01_00115066 predicted 1229
5 SASI_Rn01_00115067 predicted 473
6 SASI_Rn02_00201809 predicted 255
7 SASI_Rn01_00115068 predicted 358
8 SASI_Rn01_00115069 predicted 1043
9 SASI_Rn01_00115070 predicted 409
10 SASI_Rn01_00115071 predicted 351
11 SASI_Rn01_00115072 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171520 predicted 364
2 SASI_Mm01_00171521 predicted 1430
3 SASI_Mm01_00171522 predicted 1318
4 SASI_Mm01_00171523 predicted 470
5 SASI_Mm01_00171524 predicted 421
6 SASI_Mm01_00171525 predicted 315
7 SASI_Mm02_00343796 predicted 429
8 SASI_Mm01_00171526 predicted 529
9 SASI_Mm01_00171527 predicted 1116
10 SASI_Mm01_00171528 predicted 1126
11 SASI_Mm01_00171519 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024811
VALIDATED
CPSF7 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 7, 59kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1545s21c1
Sequence:CCGGAGATCGGCATGATGATTATTTCTCGAGAAATAATCATCATGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-504s21c1
Sequence:CCGGGATCCAGGTTATTCGCTCTATCTCGAGATAGAGCGAATAACCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1963s21c1
Sequence:CCGGCCGTTCAATGGTGAGGTTGATCTCGAGATCAACCTCACCATTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024811.3-444s21c1
Sequence:CCGGTAATAGACGAGCTGCCGTTTACTCGAGTAAACGGCAGCTCGTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1522s21c1
Sequence:CCGGCACCGGGATCTGCTTCATAATCTCGAGATTATGAAGCAGATCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024811.2-1853s1c1
Sequence:CCGGCCGTTCAATGGTGAGGTTGATCTCGAGATCAACCTCACCATTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-514s1c1
Sequence:CCGGCCACAAATTGTTGGAACTCCTCTCGAGAGGAGTTCCAACAATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-394s1c1
Sequence:CCGGGATCCAGGTTATTCGCTCTATCTCGAGATAGAGCGAATAACCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-333s1c1
Sequence:CCGGGTAATAGACGAGCTGCCGTTTCTCGAGAAACGGCAGCTCGTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024811.2-2033s1c1
Sequence:CCGGCCTTTACCTTTCCAGCCCTTTCTCGAGAAAGGGCTGGAAAGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024811
VALIDATED
CPSF7 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 7, 59kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1545s21c1
Sequence:CCGGAGATCGGCATGATGATTATTTCTCGAGAAATAATCATCATGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-504s21c1
Sequence:CCGGGATCCAGGTTATTCGCTCTATCTCGAGATAGAGCGAATAACCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1963s21c1
Sequence:CCGGCCGTTCAATGGTGAGGTTGATCTCGAGATCAACCTCACCATTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024811.3-444s21c1
Sequence:CCGGTAATAGACGAGCTGCCGTTTACTCGAGTAAACGGCAGCTCGTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1522s21c1
Sequence:CCGGCACCGGGATCTGCTTCATAATCTCGAGATTATGAAGCAGATCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024811.2-1853s1c1
Sequence:CCGGCCGTTCAATGGTGAGGTTGATCTCGAGATCAACCTCACCATTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-514s1c1
Sequence:CCGGCCACAAATTGTTGGAACTCCTCTCGAGAGGAGTTCCAACAATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-394s1c1
Sequence:CCGGGATCCAGGTTATTCGCTCTATCTCGAGATAGAGCGAATAACCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-333s1c1
Sequence:CCGGGTAATAGACGAGCTGCCGTTTCTCGAGAAACGGCAGCTCGTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024811.2-2033s1c1
Sequence:CCGGCCTTTACCTTTCCAGCCCTTTCTCGAGAAAGGGCTGGAAAGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024811
VALIDATED
CPSF7 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 7, 59kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1545s21c1
Sequence:CCGGAGATCGGCATGATGATTATTTCTCGAGAAATAATCATCATGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-504s21c1
Sequence:CCGGGATCCAGGTTATTCGCTCTATCTCGAGATAGAGCGAATAACCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1963s21c1
Sequence:CCGGCCGTTCAATGGTGAGGTTGATCTCGAGATCAACCTCACCATTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024811.3-444s21c1
Sequence:CCGGTAATAGACGAGCTGCCGTTTACTCGAGTAAACGGCAGCTCGTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024811.3-1522s21c1
Sequence:CCGGCACCGGGATCTGCTTCATAATCTCGAGATTATGAAGCAGATCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024811.2-1853s1c1
Sequence:CCGGCCGTTCAATGGTGAGGTTGATCTCGAGATCAACCTCACCATTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-514s1c1
Sequence:CCGGCCACAAATTGTTGGAACTCCTCTCGAGAGGAGTTCCAACAATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-394s1c1
Sequence:CCGGGATCCAGGTTATTCGCTCTATCTCGAGATAGAGCGAATAACCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024811.2-333s1c1
Sequence:CCGGGTAATAGACGAGCTGCCGTTTCTCGAGAAACGGCAGCTCGTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024811.2-2033s1c1
Sequence:CCGGCCTTTACCTTTCCAGCCCTTTCTCGAGAAAGGGCTGGAAAGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172302
VALIDATED
CPSF7 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation specific factor 7, 59kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172302.2-2116s1c1
Sequence:CCGGCTCACATATTGACGGTTTATTCTCGAGAATAAACCGTCAATATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-773s21c1
Sequence:CCGGCCAGCGTGTTGCCCTACTTTACTCGAGTAAAGTAGGGCAACACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-1452s21c1
Sequence:CCGGAGACCGGCATGATGATTATTTCTCGAGAAATAATCATCATGCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-190s21c1
Sequence:CCGGACAGATCAGATTGACCTATATCTCGAGATATAGGTCAATCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172302.2-412s21c1
Sequence:CCGGATCCAGGTTATCCGCTCTATACTCGAGTATAGAGCGGATAACCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172302.2-2297s21c1
Sequence:CCGGATAACCAGCTCTTAGGTATTTCTCGAGAAATACCTAAGAGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172302.2-193s1c1
Sequence:CCGGGATCAGATTGACCTATATGATCTCGAGATCATATAGGTCAATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172302.2-1238s1c1
Sequence:CCGGCCATTGCAGTTATCAAACAGTCTCGAGACTGTTTGATAACTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172302
VALIDATED
CPSF7 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation specific factor 7, 59kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172302.2-2116s1c1
Sequence:CCGGCTCACATATTGACGGTTTATTCTCGAGAATAAACCGTCAATATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-773s21c1
Sequence:CCGGCCAGCGTGTTGCCCTACTTTACTCGAGTAAAGTAGGGCAACACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-1452s21c1
Sequence:CCGGAGACCGGCATGATGATTATTTCTCGAGAAATAATCATCATGCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-190s21c1
Sequence:CCGGACAGATCAGATTGACCTATATCTCGAGATATAGGTCAATCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172302.2-412s21c1
Sequence:CCGGATCCAGGTTATCCGCTCTATACTCGAGTATAGAGCGGATAACCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172302.2-2297s21c1
Sequence:CCGGATAACCAGCTCTTAGGTATTTCTCGAGAAATACCTAAGAGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172302.2-193s1c1
Sequence:CCGGGATCAGATTGACCTATATGATCTCGAGATCATATAGGTCAATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172302.2-1238s1c1
Sequence:CCGGCCATTGCAGTTATCAAACAGTCTCGAGACTGTTTGATAACTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172302
VALIDATED
CPSF7 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation specific factor 7, 59kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172302.2-2116s1c1
Sequence:CCGGCTCACATATTGACGGTTTATTCTCGAGAATAAACCGTCAATATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-773s21c1
Sequence:CCGGCCAGCGTGTTGCCCTACTTTACTCGAGTAAAGTAGGGCAACACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-1452s21c1
Sequence:CCGGAGACCGGCATGATGATTATTTCTCGAGAAATAATCATCATGCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172302.2-190s21c1
Sequence:CCGGACAGATCAGATTGACCTATATCTCGAGATATAGGTCAATCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172302.2-412s21c1
Sequence:CCGGATCCAGGTTATCCGCTCTATACTCGAGTATAGAGCGGATAACCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172302.2-2297s21c1
Sequence:CCGGATAACCAGCTCTTAGGTATTTCTCGAGAAATACCTAAGAGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172302.2-193s1c1
Sequence:CCGGGATCAGATTGACCTATATGATCTCGAGATCATATAGGTCAATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172302.2-1238s1c1
Sequence:CCGGCCATTGCAGTTATCAAACAGTCTCGAGACTGTTTGATAACTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks