EMAIL THIS PAGE TO A FRIEND

CPT1A

carnitine palmitoyltransferase 1A (liver)

62 Gene Product Result for
Synonyms: CPT1 CPT1-L L-CPT1
UniProtKB ID: P50416, Q8TCU0, Q9BWK0
Gene ID:
Human(1374) Summary: The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12894) carnitine palmitoyltransferase 1a, liver
Rat(25757) carnitine palmitoyltransferase 1a, liver
Zebrafish(558088) carnitine palmitoyltransferase 1A (liver)
cow(506812) carnitine palmitoyltransferase 1A (liver)
Horse(100009716) carnitine palmitoyltransferase 1A (liver)
domestic cat(101096105) carnitine palmitoyltransferase 1A (liver)
dog(403583) carnitine palmitoyltransferase 1A (liver)
chicken(423118) carnitine palmitoyltransferase 1A (liver)
sheep(443434) carnitine palmitoyltransferase 1A (liver)
domestic guinea pig(100728420) carnitine palmitoyltransferase 1A (liver)
naked mole-rat(101716055) carnitine palmitoyltransferase 1A (liver)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031847 Rosetta Predictions human pricing
NM_001876 siRNAs that have been validated in the lab human pricing
NM_031559 Rosetta Predictions rat pricing
NM_013495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209266 predicted 405
2 SASI_Hs01_00209267 predicted 2137
3 SASI_Hs01_00209268 predicted 1532
4 SASI_Hs01_00209269 predicted 1507
5 SASI_Hs01_00209270 predicted 1408
6 SASI_Hs01_00209271 predicted 1814
7 SASI_Hs01_00209272 predicted 1782
8 SASI_Hs01_00209273 predicted 1561
9 SASI_Hs01_00209274 predicted 1901
10 SASI_Hs01_00209275 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001876 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231321 validated 1534
1 SASI_Hs01_00231320 validated 2147
1 SASI_Hs01_00231319 validated 404
2 SASI_Hs01_00231322 predicted 1501
3 SASI_Hs01_00231323 predicted 1408
4 SASI_Hs01_00231324 predicted 1817
5 SASI_Hs01_00231325 predicted 1787
6 SASI_Hs01_00231326 predicted 1559
7 SASI_Hs01_00231327 predicted 1893
8 SASI_Hs01_00231328 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051780 predicted 1592
2 SASI_Rn01_00051781 predicted 892
3 SASI_Rn01_00051782 predicted 1789
4 SASI_Rn01_00051783 predicted 2404
5 SASI_Rn01_00051784 predicted 2067
6 SASI_Rn01_00051785 predicted 1667
7 SASI_Rn01_00051786 predicted 1287
8 SASI_Rn01_00051787 predicted 1864
9 SASI_Rn01_00051789 predicted 685
10 SASI_Rn02_00264776 predicted 328
11 SASI_Rn01_00051788 predicted 2284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198638 predicted 2435
2 SASI_Mm01_00198639 predicted 1732
3 SASI_Mm01_00198640 predicted 1886
4 SASI_Mm01_00198641 predicted 2057
5 SASI_Mm01_00198642 predicted 963
6 SASI_Mm01_00198643 predicted 1834
7 SASI_Mm01_00198644 predicted 2240
8 SASI_Mm01_00198645 predicted 289
9 SASI_Mm01_00198646 predicted 724
10 SASI_Mm01_00198647 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013495
VALIDATED
CPT1A MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 1A (liver)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-294s1c1
Sequence:CCGGGCAAAGATCAATCGGACCCTACTCGAGTAGGGTCCGATTGATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-2197s1c1
Sequence:CCGGGCTATGGTGTTTCCTACATTACTCGAGTAATGTAGGAAACACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-1766s1c1
Sequence:CCGGGCTCGCACATTACAAGGACATCTCGAGATGTCCTTGTAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013495.1-3539s1c1
Sequence:CCGGCGGTTTGGTATTCCATGTAAACTCGAGTTTACATGGAATACCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-692s1c1
Sequence:CCGGGCAGTGGTATTTGAAGCTAAACTCGAGTTTAGCTTCAAATACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-1812s21c1
Sequence:CCGGGCTCGCACATTACAAGGACATCTCGAGATGTCCTTGTAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-1350s21c1
Sequence:CCGGCGAATCGGAACAGGGATATAGCTCGAGCTATATCCCTGTTCCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013495.2-2434s21c1
Sequence:CCGGATGGACTCTAGTGATACAAACCTCGAGGTTTGTATCACTAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-340s21c1
Sequence:CCGGGCAAAGATCAATCGGACCCTACTCGAGTAGGGTCCGATTGATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013495.2-2243s21c1
Sequence:CCGGGCTATGGTGTTTCCTACATTACTCGAGTAATGTAGGAAACACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013495
VALIDATED
CPT1A MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 1A (liver)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-294s1c1
Sequence:CCGGGCAAAGATCAATCGGACCCTACTCGAGTAGGGTCCGATTGATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-2197s1c1
Sequence:CCGGGCTATGGTGTTTCCTACATTACTCGAGTAATGTAGGAAACACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-1766s1c1
Sequence:CCGGGCTCGCACATTACAAGGACATCTCGAGATGTCCTTGTAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013495.1-3539s1c1
Sequence:CCGGCGGTTTGGTATTCCATGTAAACTCGAGTTTACATGGAATACCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-692s1c1
Sequence:CCGGGCAGTGGTATTTGAAGCTAAACTCGAGTTTAGCTTCAAATACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-1812s21c1
Sequence:CCGGGCTCGCACATTACAAGGACATCTCGAGATGTCCTTGTAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-1350s21c1
Sequence:CCGGCGAATCGGAACAGGGATATAGCTCGAGCTATATCCCTGTTCCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013495.2-2434s21c1
Sequence:CCGGATGGACTCTAGTGATACAAACCTCGAGGTTTGTATCACTAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-340s21c1
Sequence:CCGGGCAAAGATCAATCGGACCCTACTCGAGTAGGGTCCGATTGATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013495.2-2243s21c1
Sequence:CCGGGCTATGGTGTTTCCTACATTACTCGAGTAATGTAGGAAACACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013495
VALIDATED
CPT1A MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 1A (liver)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-294s1c1
Sequence:CCGGGCAAAGATCAATCGGACCCTACTCGAGTAGGGTCCGATTGATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-2197s1c1
Sequence:CCGGGCTATGGTGTTTCCTACATTACTCGAGTAATGTAGGAAACACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-1766s1c1
Sequence:CCGGGCTCGCACATTACAAGGACATCTCGAGATGTCCTTGTAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013495.1-3539s1c1
Sequence:CCGGCGGTTTGGTATTCCATGTAAACTCGAGTTTACATGGAATACCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013495.1-692s1c1
Sequence:CCGGGCAGTGGTATTTGAAGCTAAACTCGAGTTTAGCTTCAAATACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-1812s21c1
Sequence:CCGGGCTCGCACATTACAAGGACATCTCGAGATGTCCTTGTAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-1350s21c1
Sequence:CCGGCGAATCGGAACAGGGATATAGCTCGAGCTATATCCCTGTTCCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013495.2-2434s21c1
Sequence:CCGGATGGACTCTAGTGATACAAACCTCGAGGTTTGTATCACTAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013495.2-340s21c1
Sequence:CCGGGCAAAGATCAATCGGACCCTACTCGAGTAGGGTCCGATTGATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013495.2-2243s21c1
Sequence:CCGGGCTATGGTGTTTCCTACATTACTCGAGTAATGTAGGAAACACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001876
VALIDATED
CPT1A MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 1A (liver)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-147s1c1
Sequence:CCGGGCCATGAAGCTCTTAGACAAACTCGAGTTTGTCTAAGAGCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001876.1-1319s1c1
Sequence:CCGGGCGTTCTTCGTGACGTTAGATCTCGAGATCTAACGTCACGAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-1415s1c1
Sequence:CCGGCGATGTTACGACAGGTGGTTTCTCGAGAAACCACCTGTCGTAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-286s1c1
Sequence:CCGGGACAACGATGTACGCCAAGATCTCGAGATCTTGGCGTACATCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-1729s1c1
Sequence:CCGGCGTAGCCTTTGGTAAAGGAATCTCGAGATTCCTTTACCAAAGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001876
VALIDATED
CPT1A MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 1A (liver)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-147s1c1
Sequence:CCGGGCCATGAAGCTCTTAGACAAACTCGAGTTTGTCTAAGAGCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001876.1-1319s1c1
Sequence:CCGGGCGTTCTTCGTGACGTTAGATCTCGAGATCTAACGTCACGAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-1415s1c1
Sequence:CCGGCGATGTTACGACAGGTGGTTTCTCGAGAAACCACCTGTCGTAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-286s1c1
Sequence:CCGGGACAACGATGTACGCCAAGATCTCGAGATCTTGGCGTACATCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-1729s1c1
Sequence:CCGGCGTAGCCTTTGGTAAAGGAATCTCGAGATTCCTTTACCAAAGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001876
VALIDATED
CPT1A MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 1A (liver)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-147s1c1
Sequence:CCGGGCCATGAAGCTCTTAGACAAACTCGAGTTTGTCTAAGAGCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001876.1-1319s1c1
Sequence:CCGGGCGTTCTTCGTGACGTTAGATCTCGAGATCTAACGTCACGAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-1415s1c1
Sequence:CCGGCGATGTTACGACAGGTGGTTTCTCGAGAAACCACCTGTCGTAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-286s1c1
Sequence:CCGGGACAACGATGTACGCCAAGATCTCGAGATCTTGGCGTACATCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001876.1-1729s1c1
Sequence:CCGGCGTAGCCTTTGGTAAAGGAATCTCGAGATTCCTTTACCAAAGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks