EMAIL THIS PAGE TO A FRIEND

CPT1B

carnitine palmitoyltransferase 1B (muscle)

135 Gene Product Result for
Synonyms: CPT1-M CPT1M CPTI CPTI-M M-CPT1 MCCPT1 MCPT1
Gene ID:
Human(1375) Summary: The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
Mouse(12895) carnitine palmitoyltransferase 1b, muscle
Rat(25756) carnitine palmitoyltransferase 1b, muscle
naked mole-rat(101724285) carnitine palmitoyltransferase 1B (muscle)
domestic guinea pig(100717974) carnitine palmitoyltransferase 1B (muscle)
sheep(443193) carnitine palmitoyltransferase 1B (muscle)
Zebrafish(449677) carnitine palmitoyltransferase 1B (muscle)
dog(481184) carnitine palmitoyltransferase 1B (muscle)
Horse(100055438) carnitine palmitoyltransferase 1B (muscle)
cow(509459) carnitine palmitoyltransferase 1B (muscle)
domestic cat(101083187) carnitine palmitoyltransferase 1B (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004377 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU191751 MISSION® esiRNA esiRNA targeting mouse Cpt1b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004377 Rosetta Predictions human pricing
NM_152245 Rosetta Predictions human pricing
NM_152246 Rosetta Predictions human pricing
NM_152247 Rosetta Predictions human pricing
NM_013200 Rosetta Predictions rat pricing
NM_009948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047341 predicted 751
2 SASI_Hs02_00337462 predicted 433
3 SASI_Hs01_00047342 predicted 934
4 SASI_Hs01_00047343 predicted 632
5 SASI_Hs01_00047345 predicted 699
6 SASI_Hs01_00047346 predicted 903
7 SASI_Hs01_00047347 predicted 771
8 SASI_Hs01_00047348 predicted 570
9 SASI_Hs01_00047349 predicted 925
10 SASI_Hs02_00337463 predicted 624
11 SASI_Hs01_00047340 predicted 399
12 SASI_Hs01_00047344 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041278 predicted 702
2 SASI_Hs02_00365743 predicted 388
3 SASI_Hs01_00041279 predicted 891
4 SASI_Hs01_00041280 predicted 580
5 SASI_Hs01_00041282 predicted 652
6 SASI_Hs01_00041283 predicted 855
7 SASI_Hs01_00041284 predicted 719
8 SASI_Hs01_00041285 predicted 530
9 SASI_Hs01_00041286 predicted 880
10 SASI_Hs02_00365744 predicted 586
11 SASI_Hs01_00041277 predicted 349
12 SASI_Hs01_00041281 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188672 predicted 749
2 SASI_Hs02_00365745 predicted 439
3 SASI_Hs01_00188673 predicted 934
4 SASI_Hs01_00188674 predicted 631
5 SASI_Hs01_00188676 predicted 704
6 SASI_Hs01_00188677 predicted 903
7 SASI_Hs01_00188678 predicted 766
8 SASI_Hs01_00188679 predicted 571
9 SASI_Hs01_00188680 predicted 922
10 SASI_Hs02_00365746 predicted 624
11 SASI_Hs01_00188671 predicted 401
12 SASI_Hs01_00188675 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161256 predicted 2876
2 SASI_Hs02_00365747 predicted 2565
3 SASI_Hs01_00161257 predicted 3055
4 SASI_Hs01_00161258 predicted 2757
5 SASI_Hs01_00161260 predicted 2822
6 SASI_Hs01_00161261 predicted 3027
7 SASI_Hs01_00161262 predicted 2892
8 SASI_Hs01_00161263 predicted 2701
9 SASI_Hs01_00161264 predicted 3047
10 SASI_Hs02_00365748 predicted 2748
11 SASI_Hs01_00161255 predicted 2523
12 SASI_Hs01_00161259 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046130 predicted 992
2 SASI_Rn01_00046131 predicted 855
3 SASI_Rn01_00046132 predicted 581
4 SASI_Rn01_00046133 predicted 1780
5 SASI_Rn02_00261073 predicted 702
6 SASI_Rn02_00261074 predicted 1045
7 SASI_Rn01_00046135 predicted 536
8 SASI_Rn01_00046136 predicted 352
9 SASI_Rn01_00046137 predicted 249
10 SASI_Rn01_00046138 predicted 1007
11 SASI_Rn01_00046134 predicted 2250
12 SASI_Rn01_00046139 predicted 2208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085642 predicted 1382
2 SASI_Mm02_00317509 predicted 200
3 SASI_Mm01_00085643 predicted 1043
4 SASI_Mm01_00085644 predicted 860
5 SASI_Mm01_00085645 predicted 1831
6 SASI_Mm01_00085646 predicted 629
7 SASI_Mm02_00317510 predicted 2293
8 SASI_Mm02_00317511 predicted 2249
9 SASI_Mm01_00085647 predicted 539
10 SASI_Mm01_00085648 predicted 948
11 SASI_Mm01_00085641 predicted 1664
12 SASI_Mm01_00085649 predicted 1650
13 SASI_Mm01_00085650 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009948
CPT1B MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 1B (muscle)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009948.2-1414s21c1
Sequence:CCGGCTCCATGGCAACTGCTATAACCTCGAGGTTATAGCAGTTGCCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009948.2-1444s21c1
Sequence:CCGGGACAAATCTTTCACCCTTATCCTCGAGGATAAGGGTGAAAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009948.1-2614s1c1
Sequence:CCGGACTTGGCTGTTAGGTGCCTATCTCGAGATAGGCACCTAACAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-1984s1c1
Sequence:CCGGGCACCTCTTCTGCCTTTACATCTCGAGATGTAAAGGCAGAAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-780s1c1
Sequence:CCGGGCAACTATTATGCCATGGATTCTCGAGAATCCATGGCATAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-1604s1c1
Sequence:CCGGGCCATCGAGAACTCGTACCAACTCGAGTTGGTACGAGTTCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-596s1c1
Sequence:CCGGCGGCCCTTATTGGATGATGAACTCGAGTTCATCATCCAATAAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009948
CPT1B MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 1B (muscle)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009948.2-1414s21c1
Sequence:CCGGCTCCATGGCAACTGCTATAACCTCGAGGTTATAGCAGTTGCCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009948.2-1444s21c1
Sequence:CCGGGACAAATCTTTCACCCTTATCCTCGAGGATAAGGGTGAAAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009948.1-2614s1c1
Sequence:CCGGACTTGGCTGTTAGGTGCCTATCTCGAGATAGGCACCTAACAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-1984s1c1
Sequence:CCGGGCACCTCTTCTGCCTTTACATCTCGAGATGTAAAGGCAGAAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-780s1c1
Sequence:CCGGGCAACTATTATGCCATGGATTCTCGAGAATCCATGGCATAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-1604s1c1
Sequence:CCGGGCCATCGAGAACTCGTACCAACTCGAGTTGGTACGAGTTCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-596s1c1
Sequence:CCGGCGGCCCTTATTGGATGATGAACTCGAGTTCATCATCCAATAAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009948
CPT1B MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 1B (muscle)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009948.2-1414s21c1
Sequence:CCGGCTCCATGGCAACTGCTATAACCTCGAGGTTATAGCAGTTGCCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009948.2-1444s21c1
Sequence:CCGGGACAAATCTTTCACCCTTATCCTCGAGGATAAGGGTGAAAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009948.1-2614s1c1
Sequence:CCGGACTTGGCTGTTAGGTGCCTATCTCGAGATAGGCACCTAACAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-1984s1c1
Sequence:CCGGGCACCTCTTCTGCCTTTACATCTCGAGATGTAAAGGCAGAAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-780s1c1
Sequence:CCGGGCAACTATTATGCCATGGATTCTCGAGAATCCATGGCATAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-1604s1c1
Sequence:CCGGGCCATCGAGAACTCGTACCAACTCGAGTTGGTACGAGTTCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009948.1-596s1c1
Sequence:CCGGCGGCCCTTATTGGATGATGAACTCGAGTTCATCATCCAATAAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004377
CPT1B MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 1B (muscle)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004377.2-2657s1c1
Sequence:CCGGAGCCCTTAGGTACCTGTGTTTCTCGAGAAACACAGGTACCTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-540s1c1
Sequence:CCGGGCTATGTGTATCCGCCTTCTACTCGAGTAGAAGGCGGATACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-2223s1c1
Sequence:CCGGCCTGTAGCAGATGATGGCTATCTCGAGATAGCCATCATCTGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-1004s1c1
Sequence:CCGGCCAGATGGAGAGGATGTTCAACTCGAGTTGAACATCCTCTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-1989s1c1
Sequence:CCGGGCTGCTAAGAAGCACCAGAATCTCGAGATTCTGGTGCTTCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004377
CPT1B MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 1B (muscle)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004377.2-2657s1c1
Sequence:CCGGAGCCCTTAGGTACCTGTGTTTCTCGAGAAACACAGGTACCTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-540s1c1
Sequence:CCGGGCTATGTGTATCCGCCTTCTACTCGAGTAGAAGGCGGATACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-2223s1c1
Sequence:CCGGCCTGTAGCAGATGATGGCTATCTCGAGATAGCCATCATCTGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-1004s1c1
Sequence:CCGGCCAGATGGAGAGGATGTTCAACTCGAGTTGAACATCCTCTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-1989s1c1
Sequence:CCGGGCTGCTAAGAAGCACCAGAATCTCGAGATTCTGGTGCTTCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004377
CPT1B MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 1B (muscle)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004377.2-2657s1c1
Sequence:CCGGAGCCCTTAGGTACCTGTGTTTCTCGAGAAACACAGGTACCTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-540s1c1
Sequence:CCGGGCTATGTGTATCCGCCTTCTACTCGAGTAGAAGGCGGATACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-2223s1c1
Sequence:CCGGCCTGTAGCAGATGATGGCTATCTCGAGATAGCCATCATCTGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-1004s1c1
Sequence:CCGGCCAGATGGAGAGGATGTTCAACTCGAGTTGAACATCCTCTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004377.2-1989s1c1
Sequence:CCGGGCTGCTAAGAAGCACCAGAATCTCGAGATTCTGGTGCTTCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks