EMAIL THIS PAGE TO A FRIEND

CPT1C

carnitine palmitoyltransferase 1C

97 Gene Product Result for
Synonyms: CATL1 CPT1-B CPT1P CPTI-B CPTIC
UniProtKB ID: Q8TCG5, A8K0Z8, Q5K6N5, Q8N6Q9, Q8NDS6, Q8TE84
Gene ID:
Human(126129) Summary: This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein regulates the beta-oxidation and transport of long-chain fatty acids into mitochondria, and may play a role in the regulation of feeding behavior and whole-body energy homeostasis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(78070) carnitine palmitoyltransferase 1c
Rat(308579) carnitine palmitoyltransferase 1c
dog(476410) carnitine palmitoyltransferase 1C
cow(513710) carnitine palmitoyltransferase 1C
Horse(100056027) carnitine palmitoyltransferase 1C
domestic cat(101095144) carnitine palmitoyltransferase 1C
sheep(101113171) carnitine palmitoyltransferase 1C
domestic guinea pig(100722877) carnitine palmitoyltransferase 1C
naked mole-rat(101719936) carnitine palmitoyltransferase 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152359 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152359 Rosetta Predictions human pricing
NM_001034925 Rosetta Predictions rat pricing
XM_001075677 Rosetta Predictions rat pricing
XM_001075728 Rosetta Predictions rat pricing
XM_001078481 Rosetta Predictions rat pricing
XM_001078512 Rosetta Predictions rat pricing
NM_153679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235971 predicted 1534
2 SASI_Hs01_00235973 predicted 1934
3 SASI_Hs01_00235974 predicted 1841
4 SASI_Hs01_00235975 predicted 1567
5 SASI_Hs01_00235976 predicted 954
6 SASI_Hs02_00366001 predicted 929
7 SASI_Hs01_00235978 predicted 2274
8 SASI_Hs02_00366002 predicted 863
9 SASI_Hs01_00235979 predicted 2166
10 SASI_Hs01_00235980 predicted 333
11 SASI_Hs01_00235972 predicted 2356
12 SASI_Hs01_00235977 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204067 predicted 1932
2 SASI_Rn02_00204068 predicted 856
3 SASI_Rn02_00204069 predicted 2019
4 SASI_Rn02_00204070 predicted 438
5 SASI_Rn02_00204071 predicted 2284
6 SASI_Rn02_00204072 predicted 950
7 SASI_Rn02_00204073 predicted 2006
8 SASI_Rn02_00204074 predicted 908
9 SASI_Rn02_00204075 predicted 336
10 SASI_Rn02_00204076 predicted 1937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350665 predicted 556
2 SASI_Rn02_00350666 predicted 1097
3 SASI_Rn02_00350667 predicted 1246
4 SASI_Rn02_00350668 predicted 627
5 SASI_Rn02_00350669 predicted 784
6 SASI_Rn02_00350670 predicted 1045
7 SASI_Rn02_00350671 predicted 1028
8 SASI_Rn02_00350672 predicted 766
9 SASI_Rn02_00350673 predicted 519
10 SASI_Rn02_00350674 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350828 predicted 1785
2 SASI_Rn02_00350829 predicted 2332
3 SASI_Rn02_00350830 predicted 2480
4 SASI_Rn02_00350831 predicted 1859
5 SASI_Rn02_00350832 predicted 2011
6 SASI_Rn02_00350833 predicted 2275
7 SASI_Rn02_00350834 predicted 2257
8 SASI_Rn02_00350835 predicted 2000
9 SASI_Rn02_00350836 predicted 1751
10 SASI_Rn02_00350837 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360907 predicted 552
2 SASI_Rn02_00360908 predicted 1095
3 SASI_Rn02_00360909 predicted 290
4 SASI_Rn02_00360910 predicted 1244
5 SASI_Rn02_00360911 predicted 628
6 SASI_Rn02_00360912 predicted 786
7 SASI_Rn02_00360913 predicted 1044
8 SASI_Rn02_00360914 predicted 769
9 SASI_Rn02_00360915 predicted 521
10 SASI_Rn02_00360916 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361059 predicted 1924
2 SASI_Rn02_00361060 predicted 849
3 SASI_Rn02_00361061 predicted 2017
4 SASI_Rn02_00361062 predicted 430
5 SASI_Rn02_00361063 predicted 2278
6 SASI_Rn02_00361064 predicted 939
7 SASI_Rn02_00361065 predicted 2000
8 SASI_Rn02_00361066 predicted 895
9 SASI_Rn02_00361067 predicted 323
10 SASI_Rn02_00361068 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115945 predicted 855
2 SASI_Mm01_00115946 predicted 429
3 SASI_Mm01_00115947 predicted 2260
4 SASI_Mm01_00115948 predicted 1092
5 SASI_Mm01_00115949 predicted 1920
6 SASI_Mm01_00115950 predicted 941
7 SASI_Mm01_00115951 predicted 2272
8 SASI_Mm01_00115952 predicted 2104
9 SASI_Mm02_00343464 predicted 2142
10 SASI_Mm01_00115953 predicted 2128
11 SASI_Mm01_00115954 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153679
VALIDATED
CPT1C MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 1C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-945s1c1
Sequence:CCGGGCACCTACTACATGATGGATTCTCGAGAATCCATCATGTAGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-2335s1c1
Sequence:CCGGGTATGGTATCTCCTACATCTTCTCGAGAAGATGTAGGAGATACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-2332s1c1
Sequence:CCGGTGGGTATGGTATCTCCTACATCTCGAGATGTAGGAGATACCATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153679.1-743s1c1
Sequence:CCGGCGCAAGTACCTAGAGTCTGTACTCGAGTACAGACTCTAGGTACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-1425s1c1
Sequence:CCGGCCTTCTTTGTGTCCCTCGATTCTCGAGAATCGAGGGACACAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153679
VALIDATED
CPT1C MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 1C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-945s1c1
Sequence:CCGGGCACCTACTACATGATGGATTCTCGAGAATCCATCATGTAGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-2335s1c1
Sequence:CCGGGTATGGTATCTCCTACATCTTCTCGAGAAGATGTAGGAGATACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-2332s1c1
Sequence:CCGGTGGGTATGGTATCTCCTACATCTCGAGATGTAGGAGATACCATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153679.1-743s1c1
Sequence:CCGGCGCAAGTACCTAGAGTCTGTACTCGAGTACAGACTCTAGGTACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-1425s1c1
Sequence:CCGGCCTTCTTTGTGTCCCTCGATTCTCGAGAATCGAGGGACACAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153679
VALIDATED
CPT1C MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 1C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-945s1c1
Sequence:CCGGGCACCTACTACATGATGGATTCTCGAGAATCCATCATGTAGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-2335s1c1
Sequence:CCGGGTATGGTATCTCCTACATCTTCTCGAGAAGATGTAGGAGATACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-2332s1c1
Sequence:CCGGTGGGTATGGTATCTCCTACATCTCGAGATGTAGGAGATACCATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153679.1-743s1c1
Sequence:CCGGCGCAAGTACCTAGAGTCTGTACTCGAGTACAGACTCTAGGTACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153679.1-1425s1c1
Sequence:CCGGCCTTCTTTGTGTCCCTCGATTCTCGAGAATCGAGGGACACAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152359
CPT1C MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 1C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-2291s1c1
Sequence:CCGGGTCCACAATTACCCGGACTATCTCGAGATAGTCCGGGTAATTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-334s1c1
Sequence:CCGGCTCACGTTTCTGGAATGACTTCTCGAGAAGTCATTCCAGAAACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-445s1c1
Sequence:CCGGCTTAGGACTGATGGAGAAGATCTCGAGATCTTCTCCATCAGTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-2336s1c1
Sequence:CCGGCCTGCTGATGACCATGGTTATCTCGAGATAACCATGGTCATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-1838s1c1
Sequence:CCGGGTCGTTCCATTCTCCCTATTTCTCGAGAAATAGGGAGAATGGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-878s21c1
Sequence:CCGGTCCTGGTGGGCGTCCAATTATCTCGAGATAATTGGACGCCCACCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-686s21c1
Sequence:CCGGCACCCGATGCTGTTCAGTTACCTCGAGGTAACTGAACAGCATCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-1542s21c1
Sequence:CCGGATGATCGCTGGTTTGACAAATCTCGAGATTTGTCAAACCAGCGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152359
CPT1C MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 1C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-2291s1c1
Sequence:CCGGGTCCACAATTACCCGGACTATCTCGAGATAGTCCGGGTAATTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-334s1c1
Sequence:CCGGCTCACGTTTCTGGAATGACTTCTCGAGAAGTCATTCCAGAAACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-445s1c1
Sequence:CCGGCTTAGGACTGATGGAGAAGATCTCGAGATCTTCTCCATCAGTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-2336s1c1
Sequence:CCGGCCTGCTGATGACCATGGTTATCTCGAGATAACCATGGTCATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-1838s1c1
Sequence:CCGGGTCGTTCCATTCTCCCTATTTCTCGAGAAATAGGGAGAATGGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-878s21c1
Sequence:CCGGTCCTGGTGGGCGTCCAATTATCTCGAGATAATTGGACGCCCACCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-686s21c1
Sequence:CCGGCACCCGATGCTGTTCAGTTACCTCGAGGTAACTGAACAGCATCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-1542s21c1
Sequence:CCGGATGATCGCTGGTTTGACAAATCTCGAGATTTGTCAAACCAGCGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152359
CPT1C MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 1C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-2291s1c1
Sequence:CCGGGTCCACAATTACCCGGACTATCTCGAGATAGTCCGGGTAATTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-334s1c1
Sequence:CCGGCTCACGTTTCTGGAATGACTTCTCGAGAAGTCATTCCAGAAACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-445s1c1
Sequence:CCGGCTTAGGACTGATGGAGAAGATCTCGAGATCTTCTCCATCAGTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-2336s1c1
Sequence:CCGGCCTGCTGATGACCATGGTTATCTCGAGATAACCATGGTCATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152359.1-1838s1c1
Sequence:CCGGGTCGTTCCATTCTCCCTATTTCTCGAGAAATAGGGAGAATGGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-878s21c1
Sequence:CCGGTCCTGGTGGGCGTCCAATTATCTCGAGATAATTGGACGCCCACCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-686s21c1
Sequence:CCGGCACCCGATGCTGTTCAGTTACCTCGAGGTAACTGAACAGCATCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152359.1-1542s21c1
Sequence:CCGGATGATCGCTGGTTTGACAAATCTCGAGATTTGTCAAACCAGCGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks