EMAIL THIS PAGE TO A FRIEND

CPT2

carnitine palmitoyltransferase 2

60 Gene Product Result for
Synonyms: CPT1 CPTASE IIAE4
UniProtKB ID: P23786, B2R6S0, Q5SW68, Q9BQ26
Gene ID:
Human(1376) Summary: The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]
Mouse(12896) carnitine palmitoyltransferase 2
Rat(25413) carnitine palmitoyltransferase 2
naked mole-rat(101709766) carnitine palmitoyltransferase 2
domestic guinea pig(100728173) carnitine palmitoyltransferase 2
sheep(101118317) carnitine palmitoyltransferase 2
Domestic Rabbit(100346210) carnitine palmitoyltransferase 2
Zebrafish(100005717) carnitine palmitoyltransferase II
chicken(424649) carnitine palmitoyltransferase 2
cow(504502) carnitine palmitoyltransferase 2
domestic cat(101093287) carnitine palmitoyltransferase 2
dog(489585) carnitine palmitoyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501390 Anti-CPT2 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, mouse, canine, pig, rat
ELISA, western blot pricing
SAB2501391 Anti-CPT2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405653 Anti-CPT2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1401081 Anti-CPT2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
HPA028201 Anti-CPT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA028202 Anti-CPT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
HPA028214 Anti-CPT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0001376M2 Monoclonal Anti-CPT2 antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403691 Monoclonal Anti-CPT2 antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000098 Rosetta Predictions human pricing
NM_012930 Rosetta Predictions rat pricing
NM_009949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121386 predicted 1396
2 SASI_Hs01_00121387 predicted 1240
3 SASI_Hs01_00121388 predicted 973
4 SASI_Hs01_00121389 predicted 896
5 SASI_Hs01_00121391 predicted 1777
6 SASI_Hs01_00121392 predicted 2244
7 SASI_Hs01_00121393 predicted 1838
8 SASI_Hs01_00121394 predicted 1081
9 SASI_Hs01_00121395 predicted 707
10 SASI_Hs02_00301866 predicted 1598
11 SASI_Hs01_00121390 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069673 predicted 1761
2 SASI_Rn01_00069674 predicted 910
3 SASI_Rn01_00069675 predicted 1053
4 SASI_Rn01_00069676 predicted 496
5 SASI_Rn01_00069677 predicted 745
6 SASI_Rn01_00069679 predicted 1961
7 SASI_Rn01_00069680 predicted 1892
8 SASI_Rn01_00069681 predicted 478
9 SASI_Rn01_00069682 predicted 2074
10 SASI_Rn02_00260476 predicted 1704
11 SASI_Rn01_00069678 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130222 predicted 520
2 SASI_Mm01_00130223 predicted 1780
3 SASI_Mm01_00130225 predicted 1440
4 SASI_Mm01_00130226 predicted 2014
5 SASI_Mm01_00130227 predicted 1851
6 SASI_Mm01_00130228 predicted 926
7 SASI_Mm01_00130229 predicted 1861
8 SASI_Mm01_00130230 predicted 1779
9 SASI_Mm01_00130231 predicted 913
10 SASI_Mm02_00317512 predicted 1702
11 SASI_Mm01_00130224 predicted 1567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009949
VALIDATED
CPT2 MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009949.2-2124s21c1
Sequence:CCGGCATTCTTCCTCATGAACATTGCTCGAGCAATGTTCATGAGGAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1172s21c1
Sequence:CCGGGCTGGTTTGATAAGTCCTTTACTCGAGTAAAGGACTTATCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1851s21c1
Sequence:CCGGCCCTGCATACCAGCGGATAAACTCGAGTTTATCCGCTGGTATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1541s21c1
Sequence:CCGGTGGCTTTCCTGCGACAGTATGCTCGAGCATACTGTCGCAGGAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009949.2-541s21c1
Sequence:CCGGGACCCGAAGTCTGAGTATAATCTCGAGATTATACTCAGACTTCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-701s1c1
Sequence:CCGGCCTGGATATGTCCCAATATTTCTCGAGAAATATTGGGACATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009949.1-1911s1c1
Sequence:CCGGGCTGTTCACGATGACTGGATACTCGAGTATCCAGTCATCGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-1117s1c1
Sequence:CCGGGCTGGTTTGATAAGTCCTTTACTCGAGTAAAGGACTTATCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-1805s1c1
Sequence:CCGGCCAGCGGATAAACCACAACATCTCGAGATGTTGTGGTTTATCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-2064s1c1
Sequence:CCGGGCCTCCATTCTTCCTCATGAACTCGAGTTCATGAGGAAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009949
VALIDATED
CPT2 MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009949.2-2124s21c1
Sequence:CCGGCATTCTTCCTCATGAACATTGCTCGAGCAATGTTCATGAGGAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1172s21c1
Sequence:CCGGGCTGGTTTGATAAGTCCTTTACTCGAGTAAAGGACTTATCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1851s21c1
Sequence:CCGGCCCTGCATACCAGCGGATAAACTCGAGTTTATCCGCTGGTATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1541s21c1
Sequence:CCGGTGGCTTTCCTGCGACAGTATGCTCGAGCATACTGTCGCAGGAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009949.2-541s21c1
Sequence:CCGGGACCCGAAGTCTGAGTATAATCTCGAGATTATACTCAGACTTCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-701s1c1
Sequence:CCGGCCTGGATATGTCCCAATATTTCTCGAGAAATATTGGGACATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009949.1-1911s1c1
Sequence:CCGGGCTGTTCACGATGACTGGATACTCGAGTATCCAGTCATCGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-1117s1c1
Sequence:CCGGGCTGGTTTGATAAGTCCTTTACTCGAGTAAAGGACTTATCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-1805s1c1
Sequence:CCGGCCAGCGGATAAACCACAACATCTCGAGATGTTGTGGTTTATCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-2064s1c1
Sequence:CCGGGCCTCCATTCTTCCTCATGAACTCGAGTTCATGAGGAAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009949
VALIDATED
CPT2 MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009949.2-2124s21c1
Sequence:CCGGCATTCTTCCTCATGAACATTGCTCGAGCAATGTTCATGAGGAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1172s21c1
Sequence:CCGGGCTGGTTTGATAAGTCCTTTACTCGAGTAAAGGACTTATCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1851s21c1
Sequence:CCGGCCCTGCATACCAGCGGATAAACTCGAGTTTATCCGCTGGTATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009949.2-1541s21c1
Sequence:CCGGTGGCTTTCCTGCGACAGTATGCTCGAGCATACTGTCGCAGGAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009949.2-541s21c1
Sequence:CCGGGACCCGAAGTCTGAGTATAATCTCGAGATTATACTCAGACTTCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-701s1c1
Sequence:CCGGCCTGGATATGTCCCAATATTTCTCGAGAAATATTGGGACATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009949.1-1911s1c1
Sequence:CCGGGCTGTTCACGATGACTGGATACTCGAGTATCCAGTCATCGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-1117s1c1
Sequence:CCGGGCTGGTTTGATAAGTCCTTTACTCGAGTAAAGGACTTATCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-1805s1c1
Sequence:CCGGCCAGCGGATAAACCACAACATCTCGAGATGTTGTGGTTTATCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009949.1-2064s1c1
Sequence:CCGGGCCTCCATTCTTCCTCATGAACTCGAGTTCATGAGGAAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000098
VALIDATED
CPT2 MISSION shRNA Bacterial Glycerol Stock
carnitine palmitoyltransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-890s21c1
Sequence:CCGGCTCCGTTGTTCTGAACTTTAACTCGAGTTAAAGTTCAGAACAACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-2855s21c1
Sequence:CCGGTGTAGCCAGTGGGTGCTATTCCTCGAGGAATAGCACCCACTGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-1519s21c1
Sequence:CCGGTTGTCCACTTGTCCCACAATACTCGAGTATTGTGGGACAAGTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000098.2-2243s21c1
Sequence:CCGGCCCTGCATACGGGCAGATAAACTCGAGTTTATCTGCCCGTATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-851s21c1
Sequence:CCGGTTCGGGACCCTGGTTTGATATCTCGAGATATCAAACCAGGGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000098.x-1389s1c1
Sequence:CCGGGACCAGTGAGAACCGAGACATCTCGAGATGTCTCGGTTCTCACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-2163s1c1
Sequence:CCGGCCAGGGCTTTGACCGACACTTCTCGAGAAGTGTCGGTCAAAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000098.x-2860s1c1
Sequence:CCGGAGTGGGTGCTATTCTGTGAAACTCGAGTTTCACAGAATAGCACCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-1766s1c1
Sequence:CCGGTCGAGCTGACTGATGCCTTAACTCGAGTTAAGGCATCAGTCAGCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-726s1c1
Sequence:CCGGTCTCTTGAATGATGGCCAGTTCTCGAGAACTGGCCATCATTCAAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000098
VALIDATED
CPT2 MISSION shRNA shRNA Plasmid DNA
carnitine palmitoyltransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-890s21c1
Sequence:CCGGCTCCGTTGTTCTGAACTTTAACTCGAGTTAAAGTTCAGAACAACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-2855s21c1
Sequence:CCGGTGTAGCCAGTGGGTGCTATTCCTCGAGGAATAGCACCCACTGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-1519s21c1
Sequence:CCGGTTGTCCACTTGTCCCACAATACTCGAGTATTGTGGGACAAGTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000098.2-2243s21c1
Sequence:CCGGCCCTGCATACGGGCAGATAAACTCGAGTTTATCTGCCCGTATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-851s21c1
Sequence:CCGGTTCGGGACCCTGGTTTGATATCTCGAGATATCAAACCAGGGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000098.x-1389s1c1
Sequence:CCGGGACCAGTGAGAACCGAGACATCTCGAGATGTCTCGGTTCTCACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-2163s1c1
Sequence:CCGGCCAGGGCTTTGACCGACACTTCTCGAGAAGTGTCGGTCAAAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000098.x-2860s1c1
Sequence:CCGGAGTGGGTGCTATTCTGTGAAACTCGAGTTTCACAGAATAGCACCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-1766s1c1
Sequence:CCGGTCGAGCTGACTGATGCCTTAACTCGAGTTAAGGCATCAGTCAGCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-726s1c1
Sequence:CCGGTCTCTTGAATGATGGCCAGTTCTCGAGAACTGGCCATCATTCAAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000098
VALIDATED
CPT2 MISSION shRNA Lentiviral Transduction Particles
carnitine palmitoyltransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-890s21c1
Sequence:CCGGCTCCGTTGTTCTGAACTTTAACTCGAGTTAAAGTTCAGAACAACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-2855s21c1
Sequence:CCGGTGTAGCCAGTGGGTGCTATTCCTCGAGGAATAGCACCCACTGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-1519s21c1
Sequence:CCGGTTGTCCACTTGTCCCACAATACTCGAGTATTGTGGGACAAGTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000098.2-2243s21c1
Sequence:CCGGCCCTGCATACGGGCAGATAAACTCGAGTTTATCTGCCCGTATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000098.2-851s21c1
Sequence:CCGGTTCGGGACCCTGGTTTGATATCTCGAGATATCAAACCAGGGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000098.x-1389s1c1
Sequence:CCGGGACCAGTGAGAACCGAGACATCTCGAGATGTCTCGGTTCTCACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-2163s1c1
Sequence:CCGGCCAGGGCTTTGACCGACACTTCTCGAGAAGTGTCGGTCAAAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000098.x-2860s1c1
Sequence:CCGGAGTGGGTGCTATTCTGTGAAACTCGAGTTTCACAGAATAGCACCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-1766s1c1
Sequence:CCGGTCGAGCTGACTGATGCCTTAACTCGAGTTAAGGCATCAGTCAGCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000098.x-726s1c1
Sequence:CCGGTCTCTTGAATGATGGCCAGTTCTCGAGAACTGGCCATCATTCAAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks