EMAIL THIS PAGE TO A FRIEND

CPVL

carboxypeptidase, vitellogenic-like

86 Gene Product Result for
Synonyms: HVLP
UniProtKB ID: Q9H3G5, A4D1A4, Q6UX20, Q8NBL7, Q96AR7, Q9HB41
Gene ID:
Human(54504) Summary: The protein encoded by this gene is a carboxypeptidase and bears strong sequence similarity to serine carboxypeptidases. Carboxypeptidases are a large class of proteases that act to cleave a single amino acid from the carboxy termini of proteins or peptides. The exact function of this protein, however, has not been determined. At least two alternatively spliced transcripts which encode the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(71287) carboxypeptidase, vitellogenic-like
Rat(502774) carboxypeptidase, vitellogenic-like
Zebrafish(387531) carboxypeptidase, vitellogenic-like
cow(534518) carboxypeptidase, vitellogenic-like
Horse(100069591) carboxypeptidase, vitellogenic-like
dog(611483) carboxypeptidase, vitellogenic-like
domestic cat(101085706) carboxypeptidase, vitellogenic-like
sheep(101112477) carboxypeptidase, vitellogenic-like
domestic guinea pig(100719871) carboxypeptidase, vitellogenic-like
naked mole-rat(101702258) carboxypeptidase, vitellogenic-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038401 MISSION® esiRNA esiRNA human CPVL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019029 Rosetta Predictions human pricing
NM_031311 Rosetta Predictions human pricing
NM_001029927 Rosetta Predictions rat pricing
XM_906883 Rosetta Predictions mouse pricing
XM_984554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352585 predicted 1175
2 SASI_Hs01_00154630 predicted 807
3 SASI_Hs01_00154631 predicted 404
4 SASI_Hs01_00154632 predicted 948
5 SASI_Hs01_00154633 predicted 684
6 SASI_Hs01_00154634 predicted 1132
7 SASI_Hs01_00154635 predicted 647
8 SASI_Hs01_00154638 predicted 893
9 SASI_Hs01_00154639 predicted 735
10 SASI_Hs02_00352586 predicted 443
11 SASI_Hs01_00154636 predicted 1100
12 SASI_Hs01_00154637 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076542 predicted 1091
2 SASI_Hs01_00076543 predicted 727
3 SASI_Hs01_00076544 predicted 321
4 SASI_Hs01_00076545 predicted 858
5 SASI_Hs01_00076546 predicted 603
6 SASI_Hs01_00076547 predicted 1048
7 SASI_Hs01_00076548 predicted 557
8 SASI_Hs01_00076550 predicted 807
9 SASI_Hs01_00076551 predicted 644
10 SASI_Hs02_00358758 predicted 348
11 SASI_Hs01_00076549 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055860 predicted 457
2 SASI_Rn01_00055861 predicted 205
3 SASI_Rn01_00055862 predicted 594
4 SASI_Rn01_00055863 predicted 702
5 SASI_Rn01_00055864 predicted 278
6 SASI_Rn01_00055865 predicted 1071
7 SASI_Rn02_00203503 predicted 551
8 SASI_Rn02_00203504 predicted 373
9 SASI_Rn01_00055867 predicted 1149
10 SASI_Rn01_00055868 predicted 562
11 SASI_Rn01_00055859 predicted 1256
12 SASI_Rn01_00055866 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432902 predicted 755
2 SASI_Mm02_00432903 predicted 981
3 SASI_Mm02_00432904 predicted 227
4 SASI_Mm02_00432905 predicted 855
5 SASI_Mm02_00432906 predicted 956
6 SASI_Mm02_00432907 predicted 478
7 SASI_Mm02_00432908 predicted 689
8 SASI_Mm02_00432909 predicted 388
9 SASI_Mm02_00432910 predicted 721
10 SASI_Mm02_00432911 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448467 predicted 424
2 SASI_Mm02_00448468 predicted 600
3 SASI_Mm02_00448469 predicted 1170
4 SASI_Mm01_00272497 predicted 757
5 SASI_Mm01_00272500 predicted 855
6 SASI_Mm01_00272502 predicted 474
7 SASI_Mm01_00272505 predicted 718
8 SASI_Mm02_00448470 predicted 302
9 SASI_Mm02_00448471 predicted 934
10 SASI_Mm02_00448472 predicted 400
11 SASI_Mm01_00272498 predicted 989
12 SASI_Mm01_00272499 predicted 223
13 SASI_Mm01_00272501 predicted 901
14 SASI_Mm01_00272503 predicted 694
15 SASI_Mm01_00272504 predicted 394
16 SASI_Mm01_00272506 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019029
VALIDATED
CPVL MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase, vitellogenic-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-1054s1c1
Sequence:CCGGGCGACTTAACAAGTGATCCTTCTCGAGAAGGATCACTTGTTAAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-542s1c1
Sequence:CCGGGCCTTATGTTGTCACAAGTAACTCGAGTTACTTGTGACAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-923s1c1
Sequence:CCGGCCTGTACCAAATTGGCTTGTTCTCGAGAACAAGCCAATTTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-696s1c1
Sequence:CCGGCGGGATTTATACAGTGCACTACTCGAGTAGTGCACTGTATAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-432s21c1
Sequence:CCGGCGGCTTCCTCACCGTGAATAACTCGAGTTATTCACGGTGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-1083s21c1
Sequence:CCGGACTACTAGATGGCGACTTAACCTCGAGGTTAAGTCGCCATCTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-725s21c1
Sequence:CCGGACGATGTAGCACGGGATTTATCTCGAGATAAATCCCGTGCTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-1128s21c1
Sequence:CCGGTGTTACAGGATGTAGTAATTACTCGAGTAATTACTACATCCTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019029.2-1514s21c1
Sequence:CCGGGTGACTTCCATCAGGTAATTACTCGAGTAATTACCTGATGGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019029
VALIDATED
CPVL MISSION shRNA shRNA Plasmid DNA
carboxypeptidase, vitellogenic-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-1054s1c1
Sequence:CCGGGCGACTTAACAAGTGATCCTTCTCGAGAAGGATCACTTGTTAAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-542s1c1
Sequence:CCGGGCCTTATGTTGTCACAAGTAACTCGAGTTACTTGTGACAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-923s1c1
Sequence:CCGGCCTGTACCAAATTGGCTTGTTCTCGAGAACAAGCCAATTTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-696s1c1
Sequence:CCGGCGGGATTTATACAGTGCACTACTCGAGTAGTGCACTGTATAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-432s21c1
Sequence:CCGGCGGCTTCCTCACCGTGAATAACTCGAGTTATTCACGGTGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-1083s21c1
Sequence:CCGGACTACTAGATGGCGACTTAACCTCGAGGTTAAGTCGCCATCTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-725s21c1
Sequence:CCGGACGATGTAGCACGGGATTTATCTCGAGATAAATCCCGTGCTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-1128s21c1
Sequence:CCGGTGTTACAGGATGTAGTAATTACTCGAGTAATTACTACATCCTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019029.2-1514s21c1
Sequence:CCGGGTGACTTCCATCAGGTAATTACTCGAGTAATTACCTGATGGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019029
VALIDATED
CPVL MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase, vitellogenic-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-1054s1c1
Sequence:CCGGGCGACTTAACAAGTGATCCTTCTCGAGAAGGATCACTTGTTAAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-542s1c1
Sequence:CCGGGCCTTATGTTGTCACAAGTAACTCGAGTTACTTGTGACAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-923s1c1
Sequence:CCGGCCTGTACCAAATTGGCTTGTTCTCGAGAACAAGCCAATTTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019029.1-696s1c1
Sequence:CCGGCGGGATTTATACAGTGCACTACTCGAGTAGTGCACTGTATAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-432s21c1
Sequence:CCGGCGGCTTCCTCACCGTGAATAACTCGAGTTATTCACGGTGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-1083s21c1
Sequence:CCGGACTACTAGATGGCGACTTAACCTCGAGGTTAAGTCGCCATCTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-725s21c1
Sequence:CCGGACGATGTAGCACGGGATTTATCTCGAGATAAATCCCGTGCTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019029.2-1128s21c1
Sequence:CCGGTGTTACAGGATGTAGTAATTACTCGAGTAATTACTACATCCTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019029.2-1514s21c1
Sequence:CCGGGTGACTTCCATCAGGTAATTACTCGAGTAATTACCTGATGGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132566
CPVL MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase, vitellogenic-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-661s1c1
Sequence:CCGGGCGAGTCTTATGCAGGGAAATCTCGAGATTTCCCTGCATAAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-891s1c1
Sequence:CCGGCCCAAGGAGCAAAGTTACTTTCTCGAGAAAGTAACTTTGCTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-628s1c1
Sequence:CCGGCCGAGTATGCAAAGAATGATTCTCGAGAATCATTCTTTGCATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-105s1c1
Sequence:CCGGCCTGGTGATGGACTGTTTCATCTCGAGATGAAACAGTCCATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132566
CPVL MISSION shRNA shRNA Plasmid DNA
carboxypeptidase, vitellogenic-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-661s1c1
Sequence:CCGGGCGAGTCTTATGCAGGGAAATCTCGAGATTTCCCTGCATAAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-891s1c1
Sequence:CCGGCCCAAGGAGCAAAGTTACTTTCTCGAGAAAGTAACTTTGCTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-628s1c1
Sequence:CCGGCCGAGTATGCAAAGAATGATTCTCGAGAATCATTCTTTGCATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-105s1c1
Sequence:CCGGCCTGGTGATGGACTGTTTCATCTCGAGATGAAACAGTCCATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132566
CPVL MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase, vitellogenic-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-661s1c1
Sequence:CCGGGCGAGTCTTATGCAGGGAAATCTCGAGATTTCCCTGCATAAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-891s1c1
Sequence:CCGGCCCAAGGAGCAAAGTTACTTTCTCGAGAAAGTAACTTTGCTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-628s1c1
Sequence:CCGGCCGAGTATGCAAAGAATGATTCTCGAGAATCATTCTTTGCATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132566.1-105s1c1
Sequence:CCGGCCTGGTGATGGACTGTTTCATCTCGAGATGAAACAGTCCATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks