EMAIL THIS PAGE TO A FRIEND

CPXCR1

CPX chromosome region, candidate 1

48 Gene Product Result for
Synonyms: CT77
UniProtKB ID: Q8N123, B2R9F9, D3DTE7, Q96RS3
Gene ID:
Human(53336) Summary: This gene is one of several genes identified in a region of the X chromosome associated with an X-linked cleft palate (CPX) disorder. The encoded protein contains a motif similar to a motif found in zinc-finger proteins. Mutation analysis of this gene has not revealed any mutation which causes the CPX disorder. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]
Mouse(382239) CPX chromosome region, candidate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033048 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU162331 MISSION® esiRNA esiRNA targeting mouse Cpxcr1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033048 Rosetta Predictions human pricing
NM_001033471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360739 predicted 687
2 SASI_Hs01_00034210 predicted 756
3 SASI_Hs01_00034211 predicted 910
4 SASI_Hs01_00034212 predicted 962
5 SASI_Hs01_00034213 predicted 703
6 SASI_Hs01_00034214 predicted 1042
7 SASI_Hs02_00360740 predicted 958
8 SASI_Hs01_00034215 predicted 367
9 SASI_Hs01_00034216 predicted 660
10 SASI_Hs01_00034217 predicted 947
11 SASI_Hs01_00034209 predicted 992
12 SASI_Hs01_00034218 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077315 predicted 922
2 SASI_Mm01_00077316 predicted 1240
3 SASI_Mm01_00077317 predicted 660
4 SASI_Mm01_00077318 predicted 1084
5 SASI_Mm01_00077319 predicted 305
6 SASI_Mm01_00077320 predicted 1163
7 SASI_Mm01_00077321 predicted 876
8 SASI_Mm02_00288821 predicted 505
9 SASI_Mm01_00077323 predicted 1181
10 SASI_Mm02_00288822 predicted 1188
11 SASI_Mm01_00077322 predicted 452
12 SASI_Mm01_00077324 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033471
CPXCR1 MISSION shRNA Bacterial Glycerol Stock
CPX chromosome region, candidate 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-1049s21c1
Sequence:CCGGTCATAAGCTGAGGCTAGTAATCTCGAGATTACTAGCCTCAGCTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-767s21c1
Sequence:CCGGGGCAGAATGTCACCAACATAACTCGAGTTATGTTGGTGACATTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033471.3-1244s21c1
Sequence:CCGGCAATATCTCATGATCAGTAAACTCGAGTTTACTGATCATGAGATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-696s21c1
Sequence:CCGGGTCCCATTCTTTACTACTAATCTCGAGATTAGTAGTAAAGAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-500s21c1
Sequence:CCGGGTTGACCATTCCAAGGTTAATCTCGAGATTAACCTTGGAATGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033471
CPXCR1 MISSION shRNA shRNA Plasmid DNA
CPX chromosome region, candidate 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-1049s21c1
Sequence:CCGGTCATAAGCTGAGGCTAGTAATCTCGAGATTACTAGCCTCAGCTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-767s21c1
Sequence:CCGGGGCAGAATGTCACCAACATAACTCGAGTTATGTTGGTGACATTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033471.3-1244s21c1
Sequence:CCGGCAATATCTCATGATCAGTAAACTCGAGTTTACTGATCATGAGATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-696s21c1
Sequence:CCGGGTCCCATTCTTTACTACTAATCTCGAGATTAGTAGTAAAGAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-500s21c1
Sequence:CCGGGTTGACCATTCCAAGGTTAATCTCGAGATTAACCTTGGAATGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033471
CPXCR1 MISSION shRNA Lentiviral Transduction Particles
CPX chromosome region, candidate 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-1049s21c1
Sequence:CCGGTCATAAGCTGAGGCTAGTAATCTCGAGATTACTAGCCTCAGCTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-767s21c1
Sequence:CCGGGGCAGAATGTCACCAACATAACTCGAGTTATGTTGGTGACATTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033471.3-1244s21c1
Sequence:CCGGCAATATCTCATGATCAGTAAACTCGAGTTTACTGATCATGAGATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-696s21c1
Sequence:CCGGGTCCCATTCTTTACTACTAATCTCGAGATTAGTAGTAAAGAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033471.3-500s21c1
Sequence:CCGGGTTGACCATTCCAAGGTTAATCTCGAGATTAACCTTGGAATGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033048
CPXCR1 MISSION shRNA Bacterial Glycerol Stock
CPX chromosome region, candidate 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-440s1c1
Sequence:CCGGGAGCTCGAAACAGAGATCCAACTCGAGTTGGATCTCTGTTTCGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-935s1c1
Sequence:CCGGGTGCTCTTTGTGTCACAGATACTCGAGTATCTGTGACACAAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-312s1c1
Sequence:CCGGGTACAGACATAGAGTCTCCATCTCGAGATGGAGACTCTATGTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-678s1c1
Sequence:CCGGGTATGATTCTCCATCTGCTATCTCGAGATAGCAGATGGAGAATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033048.3-1356s1c1
Sequence:CCGGCCTGTCATCTATATTGAGTCACTCGAGTGACTCAATATAGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-688s1c1
Sequence:CCGGCCATCTGCTATGTGATAGATACTCGAGTATCTATCACATAGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-341s1c1
Sequence:CCGGCCCAATATGATCTATCAGGTACTCGAGTACCTGATAGATCATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-729s1c1
Sequence:CCGGGTCAGAATACCATGTGGGTAACTCGAGTTACCCACATGGTATTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-806s1c1
Sequence:CCGGGCCATAACATTTAGAAGGCCTCTCGAGAGGCCTTCTAAATGTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033048
CPXCR1 MISSION shRNA shRNA Plasmid DNA
CPX chromosome region, candidate 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-440s1c1
Sequence:CCGGGAGCTCGAAACAGAGATCCAACTCGAGTTGGATCTCTGTTTCGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-935s1c1
Sequence:CCGGGTGCTCTTTGTGTCACAGATACTCGAGTATCTGTGACACAAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-312s1c1
Sequence:CCGGGTACAGACATAGAGTCTCCATCTCGAGATGGAGACTCTATGTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-678s1c1
Sequence:CCGGGTATGATTCTCCATCTGCTATCTCGAGATAGCAGATGGAGAATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033048.3-1356s1c1
Sequence:CCGGCCTGTCATCTATATTGAGTCACTCGAGTGACTCAATATAGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-688s1c1
Sequence:CCGGCCATCTGCTATGTGATAGATACTCGAGTATCTATCACATAGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-341s1c1
Sequence:CCGGCCCAATATGATCTATCAGGTACTCGAGTACCTGATAGATCATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-729s1c1
Sequence:CCGGGTCAGAATACCATGTGGGTAACTCGAGTTACCCACATGGTATTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-806s1c1
Sequence:CCGGGCCATAACATTTAGAAGGCCTCTCGAGAGGCCTTCTAAATGTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033048
CPXCR1 MISSION shRNA Lentiviral Transduction Particles
CPX chromosome region, candidate 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-440s1c1
Sequence:CCGGGAGCTCGAAACAGAGATCCAACTCGAGTTGGATCTCTGTTTCGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-935s1c1
Sequence:CCGGGTGCTCTTTGTGTCACAGATACTCGAGTATCTGTGACACAAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-312s1c1
Sequence:CCGGGTACAGACATAGAGTCTCCATCTCGAGATGGAGACTCTATGTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-678s1c1
Sequence:CCGGGTATGATTCTCCATCTGCTATCTCGAGATAGCAGATGGAGAATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033048.3-1356s1c1
Sequence:CCGGCCTGTCATCTATATTGAGTCACTCGAGTGACTCAATATAGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-688s1c1
Sequence:CCGGCCATCTGCTATGTGATAGATACTCGAGTATCTATCACATAGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033048.3-341s1c1
Sequence:CCGGCCCAATATGATCTATCAGGTACTCGAGTACCTGATAGATCATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-729s1c1
Sequence:CCGGGTCAGAATACCATGTGGGTAACTCGAGTTACCCACATGGTATTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033048.3-806s1c1
Sequence:CCGGGCCATAACATTTAGAAGGCCTCTCGAGAGGCCTTCTAAATGTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks