EMAIL THIS PAGE TO A FRIEND

CPXM1

carboxypeptidase X (M14 family), member 1

51 Gene Product Result for
Synonyms: CPX1 CPXM
UniProtKB ID: Q96SM3, Q6P4G8, Q6UW65, Q9NUB5
Gene ID:
Human(56265) Summary: This gene likely encodes a member of the carboxypeptidase family of proteins. Cloning of a comparable locus in mouse indicates that the encoded protein contains a discoidin domain and a carboxypeptidase domain, but the protein appears to lack residues necessary for carboxypeptidase activity.[provided by RefSeq, May 2010]
Mouse(56264) carboxypeptidase X 1 (M14 family)
Rat(296156) carboxypeptidase X (M14 family), member 1
sheep(101103413) carboxypeptidase X (M14 family), member 1
Domestic Rabbit(100353513) carboxypeptidase X (M14 family), member 1
naked mole-rat(101711243) carboxypeptidase X (M14 family), member 1
domestic guinea pig(100722018) carboxypeptidase X (M14 family), member 1
dog(485802) carboxypeptidase X (M14 family), member 1
domestic cat(101098619) carboxypeptidase X (M14 family), member 1
cow(532219) carboxypeptidase X (M14 family), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019609 Rosetta Predictions human pricing
NM_001106511 Rosetta Predictions rat pricing
NM_019696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139902 predicted 1016
2 SASI_Hs01_00139903 predicted 1347
3 SASI_Hs01_00139904 predicted 1504
4 SASI_Hs01_00139905 predicted 282
5 SASI_Hs01_00139906 predicted 947
6 SASI_Hs01_00139907 predicted 1655
7 SASI_Hs02_00352823 predicted 218
8 SASI_Hs01_00139909 predicted 1673
9 SASI_Hs01_00139910 predicted 650
10 SASI_Hs02_00352824 predicted 390
11 SASI_Hs01_00139908 predicted 2109
12 SASI_Hs01_00139911 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219688 predicted 1631
2 SASI_Rn02_00219689 predicted 713
3 SASI_Rn02_00219690 predicted 1971
4 SASI_Rn02_00219691 predicted 1091
5 SASI_Rn02_00219692 predicted 994
6 SASI_Rn02_00219693 predicted 1754
7 SASI_Rn02_00219694 predicted 621
8 SASI_Rn02_00219695 predicted 1648
9 SASI_Rn02_00219696 predicted 1217
10 SASI_Rn02_00219697 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184212 predicted 2138
2 SASI_Mm01_00184213 predicted 1649
3 SASI_Mm01_00184214 predicted 1480
4 SASI_Mm01_00184215 predicted 1807
5 SASI_Mm01_00184216 predicted 1747
6 SASI_Mm01_00184217 predicted 1634
7 SASI_Mm01_00184218 predicted 1320
8 SASI_Mm01_00184219 predicted 622
9 SASI_Mm01_00184221 predicted 1016
10 SASI_Mm02_00324796 predicted 1779
11 SASI_Mm01_00184220 predicted 1506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019609
CPXM1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase X (M14 family), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1337s1c1
Sequence:CCGGGCATCGATCTTAACCATAATTCTCGAGAATTATGGTTAAGATCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-737s1c1
Sequence:CCGGCTGCCAATTCAGACCCAGAAACTCGAGTTTCTGGGTCTGAATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-243s1c1
Sequence:CCGGGATTCGAGTCATCAAGAAGAACTCGAGTTCTTCTTGATGACTCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1646s1c1
Sequence:CCGGGCACTGTCTATGCTGGCAGTACTCGAGTACTGCCAGCATAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1485s1c1
Sequence:CCGGGCGGGCAGTAATCAAGTGGATCTCGAGATCCACTTGATTACTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-521s21c1
Sequence:CCGGCTGGAGGACGGCGATCTATATCTCGAGATATAGATCGCCGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-298s21c1
Sequence:CCGGGCGGAAGAAGCTAACTCTAACCTCGAGGTTAGAGTTAGCTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-730s21c1
Sequence:CCGGCAGTGGGATGGACGCAGTATTCTCGAGAATACTGCGTCCATCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019609
CPXM1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase X (M14 family), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1337s1c1
Sequence:CCGGGCATCGATCTTAACCATAATTCTCGAGAATTATGGTTAAGATCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-737s1c1
Sequence:CCGGCTGCCAATTCAGACCCAGAAACTCGAGTTTCTGGGTCTGAATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-243s1c1
Sequence:CCGGGATTCGAGTCATCAAGAAGAACTCGAGTTCTTCTTGATGACTCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1646s1c1
Sequence:CCGGGCACTGTCTATGCTGGCAGTACTCGAGTACTGCCAGCATAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1485s1c1
Sequence:CCGGGCGGGCAGTAATCAAGTGGATCTCGAGATCCACTTGATTACTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-521s21c1
Sequence:CCGGCTGGAGGACGGCGATCTATATCTCGAGATATAGATCGCCGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-298s21c1
Sequence:CCGGGCGGAAGAAGCTAACTCTAACCTCGAGGTTAGAGTTAGCTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-730s21c1
Sequence:CCGGCAGTGGGATGGACGCAGTATTCTCGAGAATACTGCGTCCATCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019609
CPXM1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase X (M14 family), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1337s1c1
Sequence:CCGGGCATCGATCTTAACCATAATTCTCGAGAATTATGGTTAAGATCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-737s1c1
Sequence:CCGGCTGCCAATTCAGACCCAGAAACTCGAGTTTCTGGGTCTGAATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-243s1c1
Sequence:CCGGGATTCGAGTCATCAAGAAGAACTCGAGTTCTTCTTGATGACTCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1646s1c1
Sequence:CCGGGCACTGTCTATGCTGGCAGTACTCGAGTACTGCCAGCATAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019609.2-1485s1c1
Sequence:CCGGGCGGGCAGTAATCAAGTGGATCTCGAGATCCACTTGATTACTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-521s21c1
Sequence:CCGGCTGGAGGACGGCGATCTATATCTCGAGATATAGATCGCCGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-298s21c1
Sequence:CCGGGCGGAAGAAGCTAACTCTAACCTCGAGGTTAGAGTTAGCTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019609.3-730s21c1
Sequence:CCGGCAGTGGGATGGACGCAGTATTCTCGAGAATACTGCGTCCATCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019696
CPXM1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase X (M14 family), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1157s1c1
Sequence:CCGGGCAGTTCTTATGCCATGAGTTCTCGAGAACTCATGGCATAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1538s1c1
Sequence:CCGGGCTTGTGGTGTCCTATCCTTTCTCGAGAAAGGATAGGACACCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-263s1c1
Sequence:CCGGGATCGTTGTCAAGAAGCGAAACTCGAGTTTCGCTTCTTGACAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-531s1c1
Sequence:CCGGGCTGAGCAACAAGACACTGAACTCGAGTTCAGTGTCTTGTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1971s1c1
Sequence:CCGGGAGGGCATTAACCACGATGTTCTCGAGAACATCGTGGTTAATGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019696
CPXM1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase X (M14 family), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1157s1c1
Sequence:CCGGGCAGTTCTTATGCCATGAGTTCTCGAGAACTCATGGCATAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1538s1c1
Sequence:CCGGGCTTGTGGTGTCCTATCCTTTCTCGAGAAAGGATAGGACACCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-263s1c1
Sequence:CCGGGATCGTTGTCAAGAAGCGAAACTCGAGTTTCGCTTCTTGACAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-531s1c1
Sequence:CCGGGCTGAGCAACAAGACACTGAACTCGAGTTCAGTGTCTTGTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1971s1c1
Sequence:CCGGGAGGGCATTAACCACGATGTTCTCGAGAACATCGTGGTTAATGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019696
CPXM1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase X (M14 family), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1157s1c1
Sequence:CCGGGCAGTTCTTATGCCATGAGTTCTCGAGAACTCATGGCATAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1538s1c1
Sequence:CCGGGCTTGTGGTGTCCTATCCTTTCTCGAGAAAGGATAGGACACCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-263s1c1
Sequence:CCGGGATCGTTGTCAAGAAGCGAAACTCGAGTTTCGCTTCTTGACAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-531s1c1
Sequence:CCGGGCTGAGCAACAAGACACTGAACTCGAGTTCAGTGTCTTGTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019696.1-1971s1c1
Sequence:CCGGGAGGGCATTAACCACGATGTTCTCGAGAACATCGTGGTTAATGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks