EMAIL THIS PAGE TO A FRIEND

CPXM2

carboxypeptidase X (M14 family), member 2

91 Gene Product Result for
Synonyms: CPX2 UNQ676
UniProtKB ID: Q8N436
Gene ID:
Mouse(55987) carboxypeptidase X 2 (M14 family)
Rat(293566) carboxypeptidase X (M14 family), member 2
chicken(423951) carboxypeptidase X (M14 family), member 2
cow(534505) carboxypeptidase X (M14 family), member 2
Horse(100057636) carboxypeptidase X (M14 family), member 2
domestic cat(101097920) carboxypeptidase X (M14 family), member 2
dog(486927) carboxypeptidase X (M14 family), member 2
domestic guinea pig(100714268) carboxypeptidase X (M14 family), member 2
naked mole-rat(101696805) carboxypeptidase X (M14 family), member 2
sheep(101103861) carboxypeptidase X (M14 family), member 2
Domestic Rabbit(100352623) carboxypeptidase X (M14 family), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198148 Rosetta Predictions human pricing
NM_001106306 Rosetta Predictions rat pricing
NM_018867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152923 predicted 1294
2 SASI_Hs01_00152924 predicted 1742
3 SASI_Hs01_00152925 predicted 1336
4 SASI_Hs02_00371681 predicted 1817
5 SASI_Hs01_00152926 predicted 2144
6 SASI_Hs01_00152927 predicted 2233
7 SASI_Hs01_00152928 predicted 2217
8 SASI_Hs01_00152929 predicted 2645
9 SASI_Hs01_00152930 predicted 2385
10 SASI_Hs01_00152931 predicted 1287
11 SASI_Hs01_00152932 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217678 predicted 604
2 SASI_Rn02_00217679 predicted 596
3 SASI_Rn02_00217680 predicted 1677
4 SASI_Rn02_00217681 predicted 715
5 SASI_Rn02_00217682 predicted 1574
6 SASI_Rn02_00217683 predicted 1962
7 SASI_Rn02_00217684 predicted 1643
8 SASI_Rn02_00217685 predicted 2209
9 SASI_Rn02_00217686 predicted 2193
10 SASI_Rn02_00217687 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324244 predicted 1931
2 SASI_Mm01_00040270 predicted 2040
3 SASI_Mm01_00040272 predicted 1959
4 SASI_Mm01_00040273 predicted 2181
5 SASI_Mm01_00040274 predicted 2286
6 SASI_Mm01_00040275 predicted 1970
7 SASI_Mm01_00040276 predicted 478
8 SASI_Mm01_00040277 predicted 265
9 SASI_Mm01_00040278 predicted 1671
10 SASI_Mm01_00040279 predicted 857
11 SASI_Mm01_00040271 predicted 2097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018867
CPXM2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase X (M14 family), member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-2068s21c1
Sequence:CCGGAGGTTCATCGAGGCATCAAAGCTCGAGCTTTGATGCCTCGATGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-1510s21c1
Sequence:CCGGACAACAACTTTCCGGATTTAACTCGAGTTAAATCCGGAAAGTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-2193s21c1
Sequence:CCGGCTACTGAACCCTGGCGAATATCTCGAGATATTCGCCAGGGTTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018867.3-2839s1c1
Sequence:CCGGCCAGATGTTATCATTTGAGATCTCGAGATCTCAAATGATAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-1037s1c1
Sequence:CCGGCCGGATCCTAATAACTATTATCTCGAGATAATAGTTATTAGGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-2317s1c1
Sequence:CCGGCCTGGCTAGGATAAGAGAAATCTCGAGATTTCTCTTATCCTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-1102s1c1
Sequence:CCGGGCACCACAACTATAAGGAAATCTCGAGATTTCCTTATAGTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-883s1c1
Sequence:CCGGCGACATGATATTTGAAGGAAACTCGAGTTTCCTTCAAATATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018867
CPXM2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase X (M14 family), member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-2068s21c1
Sequence:CCGGAGGTTCATCGAGGCATCAAAGCTCGAGCTTTGATGCCTCGATGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-1510s21c1
Sequence:CCGGACAACAACTTTCCGGATTTAACTCGAGTTAAATCCGGAAAGTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-2193s21c1
Sequence:CCGGCTACTGAACCCTGGCGAATATCTCGAGATATTCGCCAGGGTTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018867.3-2839s1c1
Sequence:CCGGCCAGATGTTATCATTTGAGATCTCGAGATCTCAAATGATAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-1037s1c1
Sequence:CCGGCCGGATCCTAATAACTATTATCTCGAGATAATAGTTATTAGGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-2317s1c1
Sequence:CCGGCCTGGCTAGGATAAGAGAAATCTCGAGATTTCTCTTATCCTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-1102s1c1
Sequence:CCGGGCACCACAACTATAAGGAAATCTCGAGATTTCCTTATAGTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-883s1c1
Sequence:CCGGCGACATGATATTTGAAGGAAACTCGAGTTTCCTTCAAATATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018867
CPXM2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase X (M14 family), member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-2068s21c1
Sequence:CCGGAGGTTCATCGAGGCATCAAAGCTCGAGCTTTGATGCCTCGATGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-1510s21c1
Sequence:CCGGACAACAACTTTCCGGATTTAACTCGAGTTAAATCCGGAAAGTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018867.5-2193s21c1
Sequence:CCGGCTACTGAACCCTGGCGAATATCTCGAGATATTCGCCAGGGTTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018867.3-2839s1c1
Sequence:CCGGCCAGATGTTATCATTTGAGATCTCGAGATCTCAAATGATAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-1037s1c1
Sequence:CCGGCCGGATCCTAATAACTATTATCTCGAGATAATAGTTATTAGGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-2317s1c1
Sequence:CCGGCCTGGCTAGGATAAGAGAAATCTCGAGATTTCTCTTATCCTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-1102s1c1
Sequence:CCGGGCACCACAACTATAAGGAAATCTCGAGATTTCCTTATAGTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018867.3-883s1c1
Sequence:CCGGCGACATGATATTTGAAGGAAACTCGAGTTTCCTTCAAATATCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198148
VALIDATED
CPXM2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase X (M14 family), member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198148.1-3221s1c1
Sequence:CCGGGCTGAGATCATTCAGGAGTTTCTCGAGAAACTCCTGAATGATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-1147s1c1
Sequence:CCGGCCCTCAGTCCTGGTTTGATAACTCGAGTTATCAAACCAGGACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-1663s1c1
Sequence:CCGGCCACGATGGAATTGACATCAACTCGAGTTGATGTCAATTCCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-2239s1c1
Sequence:CCGGGCAGGTTCATCGTGGCATTAACTCGAGTTAATGCCACGATGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198148.1-1328s1c1
Sequence:CCGGTGTCCCAATATCACCAGAATTCTCGAGAATTCTGGTGATATTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198148
VALIDATED
CPXM2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase X (M14 family), member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198148.1-3221s1c1
Sequence:CCGGGCTGAGATCATTCAGGAGTTTCTCGAGAAACTCCTGAATGATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-1147s1c1
Sequence:CCGGCCCTCAGTCCTGGTTTGATAACTCGAGTTATCAAACCAGGACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-1663s1c1
Sequence:CCGGCCACGATGGAATTGACATCAACTCGAGTTGATGTCAATTCCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-2239s1c1
Sequence:CCGGGCAGGTTCATCGTGGCATTAACTCGAGTTAATGCCACGATGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198148.1-1328s1c1
Sequence:CCGGTGTCCCAATATCACCAGAATTCTCGAGAATTCTGGTGATATTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198148
VALIDATED
CPXM2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase X (M14 family), member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198148.1-3221s1c1
Sequence:CCGGGCTGAGATCATTCAGGAGTTTCTCGAGAAACTCCTGAATGATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-1147s1c1
Sequence:CCGGCCCTCAGTCCTGGTTTGATAACTCGAGTTATCAAACCAGGACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-1663s1c1
Sequence:CCGGCCACGATGGAATTGACATCAACTCGAGTTGATGTCAATTCCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198148.1-2239s1c1
Sequence:CCGGGCAGGTTCATCGTGGCATTAACTCGAGTTAATGCCACGATGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198148.1-1328s1c1
Sequence:CCGGTGTCCCAATATCACCAGAATTCTCGAGAATTCTGGTGATATTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks