EMAIL THIS PAGE TO A FRIEND

CPZ

carboxypeptidase Z

UniProtKB ID: Q66K79, O00520, Q96MX2
Gene ID:
Human(8532) Summary: This gene encodes a member of the metallocarboxypeptidase family. This enzyme displays carboxypeptidase activity towards substrates with basic C-terminal residues. It is most active at neutral pH and is inhibited by active site-directed inhibitors of metallocarboxypeptidases. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(242939) carboxypeptidase Z
Rat(83575) carboxypeptidase Z
Zebrafish(557534) carboxypeptidase Z
Thale Cress(814995) ribonuclease Z
cow(537837) carboxypeptidase Z
domestic cat(101098630) carboxypeptidase Z
dog(488792) carboxypeptidase Z
chicken(395266) carboxypeptidase Z
sheep(101120411) carboxypeptidase Z
naked mole-rat(101722655) carboxypeptidase Z
domestic guinea pig(100717227) carboxypeptidase Z
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141191 MISSION® esiRNA esiRNA human CPZ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014447 Rosetta Predictions human pricing
NM_001014448 Rosetta Predictions human pricing
NM_003652 Rosetta Predictions human pricing
NM_031766 Rosetta Predictions rat pricing
NM_153107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094852 predicted 1099
2 SASI_Hs01_00094853 predicted 1758
3 SASI_Hs01_00094854 predicted 1532
4 SASI_Hs01_00094855 predicted 1489
5 SASI_Hs01_00094856 predicted 886
6 SASI_Hs01_00094857 predicted 516
7 SASI_Hs01_00094858 predicted 583
8 SASI_Hs01_00094859 predicted 1876
9 SASI_Hs02_00306555 predicted 1479
10 SASI_Hs02_00306556 predicted 842
11 SASI_Hs01_00094851 predicted 954
12 SASI_Hs01_00094860 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122889 predicted 1365
2 SASI_Hs01_00122890 predicted 2025
3 SASI_Hs01_00122891 predicted 1799
4 SASI_Hs01_00122892 predicted 1750
5 SASI_Hs01_00122893 predicted 1149
6 SASI_Hs01_00122894 predicted 853
7 SASI_Hs01_00122895 predicted 2146
8 SASI_Hs02_00306557 predicted 1741
9 SASI_Hs01_00122897 predicted 1105
10 SASI_Hs02_00306558 predicted 1955
11 SASI_Hs01_00122888 predicted 1209
12 SASI_Hs01_00122896 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078961 predicted 1070
2 SASI_Hs01_00078962 predicted 1727
3 SASI_Hs01_00078963 predicted 1495
4 SASI_Hs01_00078964 predicted 1452
5 SASI_Hs01_00078965 predicted 849
6 SASI_Hs01_00078966 predicted 485
7 SASI_Hs01_00078967 predicted 558
8 SASI_Hs01_00078968 predicted 1844
9 SASI_Hs02_00336026 predicted 1449
10 SASI_Hs02_00336027 predicted 805
11 SASI_Hs01_00078960 predicted 921
12 SASI_Hs01_00078969 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059524 predicted 863
2 SASI_Rn01_00059525 predicted 855
3 SASI_Rn01_00059526 predicted 777
4 SASI_Rn01_00059528 predicted 533
5 SASI_Rn02_00265194 predicted 1631
6 SASI_Rn01_00059529 predicted 1734
7 SASI_Rn01_00059530 predicted 1766
8 SASI_Rn01_00059531 predicted 1745
9 SASI_Rn01_00059532 predicted 1287
10 SASI_Rn01_00059533 predicted 605
11 SASI_Rn01_00059527 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035098 predicted 1781
2 SASI_Mm01_00035099 predicted 734
3 SASI_Mm01_00035100 predicted 1473
4 SASI_Mm01_00035102 predicted 320
5 SASI_Mm01_00035103 predicted 499
6 SASI_Mm01_00035104 predicted 565
7 SASI_Mm01_00035105 predicted 1670
8 SASI_Mm01_00035106 predicted 1467
9 SASI_Mm02_00342960 predicted 267
10 SASI_Mm02_00342961 predicted 674
11 SASI_Mm01_00035101 predicted 1469
12 SASI_Mm01_00035107 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003652
VALIDATED
CPZ MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase Z
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1570s1c1
Sequence:CCGGCGGATCTCAGTCAAAGGCATTCTCGAGAATGCCTTTGACTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003652.1-960s1c1
Sequence:CCGGCCTGGATCTGAACCGAAATTTCTCGAGAAATTTCGGTTCAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1642s1c1
Sequence:CCGGCCAGGTATCCACATTGTCATTCTCGAGAATGACAATGTGGATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1566s21c1
Sequence:CCGGCAAGGAGTCACTCCTGAATTTCTCGAGAAATTCAGGAGTGACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1367s21c1
Sequence:CCGGTGATGGACAGGTCGGAGAATACTCGAGTATTCTCCGACCTGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1193s21c1
Sequence:CCGGGGATGCAGACCATACCCTTTGCTCGAGCAAAGGGTATGGTCTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-735s1c2
Sequence:CCGGCATCGGCAACATTCATGGCAACTCGAGTTGCCATGAATGTTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1732s1c2
Sequence:CCGGCGTGTGGACTTCATTCTGCAACTCGAGTTGCAGAATGAAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003652
VALIDATED
CPZ MISSION shRNA shRNA Plasmid DNA
carboxypeptidase Z
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1570s1c1
Sequence:CCGGCGGATCTCAGTCAAAGGCATTCTCGAGAATGCCTTTGACTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003652.1-960s1c1
Sequence:CCGGCCTGGATCTGAACCGAAATTTCTCGAGAAATTTCGGTTCAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1642s1c1
Sequence:CCGGCCAGGTATCCACATTGTCATTCTCGAGAATGACAATGTGGATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1566s21c1
Sequence:CCGGCAAGGAGTCACTCCTGAATTTCTCGAGAAATTCAGGAGTGACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1367s21c1
Sequence:CCGGTGATGGACAGGTCGGAGAATACTCGAGTATTCTCCGACCTGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1193s21c1
Sequence:CCGGGGATGCAGACCATACCCTTTGCTCGAGCAAAGGGTATGGTCTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-735s1c2
Sequence:CCGGCATCGGCAACATTCATGGCAACTCGAGTTGCCATGAATGTTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1732s1c2
Sequence:CCGGCGTGTGGACTTCATTCTGCAACTCGAGTTGCAGAATGAAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003652
VALIDATED
CPZ MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase Z
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1570s1c1
Sequence:CCGGCGGATCTCAGTCAAAGGCATTCTCGAGAATGCCTTTGACTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003652.1-960s1c1
Sequence:CCGGCCTGGATCTGAACCGAAATTTCTCGAGAAATTTCGGTTCAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1642s1c1
Sequence:CCGGCCAGGTATCCACATTGTCATTCTCGAGAATGACAATGTGGATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1566s21c1
Sequence:CCGGCAAGGAGTCACTCCTGAATTTCTCGAGAAATTCAGGAGTGACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1367s21c1
Sequence:CCGGTGATGGACAGGTCGGAGAATACTCGAGTATTCTCCGACCTGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003652.2-1193s21c1
Sequence:CCGGGGATGCAGACCATACCCTTTGCTCGAGCAAAGGGTATGGTCTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-735s1c2
Sequence:CCGGCATCGGCAACATTCATGGCAACTCGAGTTGCCATGAATGTTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003652.1-1732s1c2
Sequence:CCGGCGTGTGGACTTCATTCTGCAACTCGAGTTGCAGAATGAAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153107
CPZ MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase Z
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-573s1c1
Sequence:CCGGCCACCACTCCTATGCTCAAATCTCGAGATTTGAGCATAGGAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-1384s1c1
Sequence:CCGGTCTGACTTCAACTACTTACATCTCGAGATGTAAGTAGTTGAAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-177s1c1
Sequence:CCGGCGCCTATAACCATACATCGTTCTCGAGAACGATGTATGGTTATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-441s1c1
Sequence:CCGGCTTCCTTGATTGTGCCCAATACTCGAGTATTGGGCACAATCAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-1564s1c1
Sequence:CCGGCCAGTCAAGAACGCACGGATTCTCGAGAATCCGTGCGTTCTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153107
CPZ MISSION shRNA shRNA Plasmid DNA
carboxypeptidase Z
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-573s1c1
Sequence:CCGGCCACCACTCCTATGCTCAAATCTCGAGATTTGAGCATAGGAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-1384s1c1
Sequence:CCGGTCTGACTTCAACTACTTACATCTCGAGATGTAAGTAGTTGAAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-177s1c1
Sequence:CCGGCGCCTATAACCATACATCGTTCTCGAGAACGATGTATGGTTATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-441s1c1
Sequence:CCGGCTTCCTTGATTGTGCCCAATACTCGAGTATTGGGCACAATCAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-1564s1c1
Sequence:CCGGCCAGTCAAGAACGCACGGATTCTCGAGAATCCGTGCGTTCTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153107
CPZ MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase Z
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-573s1c1
Sequence:CCGGCCACCACTCCTATGCTCAAATCTCGAGATTTGAGCATAGGAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-1384s1c1
Sequence:CCGGTCTGACTTCAACTACTTACATCTCGAGATGTAAGTAGTTGAAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-177s1c1
Sequence:CCGGCGCCTATAACCATACATCGTTCTCGAGAACGATGTATGGTTATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-441s1c1
Sequence:CCGGCTTCCTTGATTGTGCCCAATACTCGAGTATTGGGCACAATCAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153107.1-1564s1c1
Sequence:CCGGCCAGTCAAGAACGCACGGATTCTCGAGAATCCGTGCGTTCTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks