EMAIL THIS PAGE TO A FRIEND

CR1

complement component (3b/4b) receptor 1 (Knops blood group)

70 Gene Product Result for
Synonyms: C3BR C4BR CD35 KN
Species: Human CR1(1378), domestic cat CR1(101094393), dog CR1(609328), Domestic Rabbit CR1(100144334), naked mole-rat Cr1(101704987)
UniProtKB ID: P17927, Q16744, Q16745, Q5SR43, Q5SR45, Q9UQV2
Gene ID:
Human(1378) Summary: This gene is a member of the receptors of complement activation (RCA) family and is located in the 'cluster RCA' region of chromosome 1. The gene encodes a monomeric single-pass type I membrane glycoprotein found on erythrocytes, leukocytes, glomerular podocytes, and splenic follicular dendritic cells. The Knops blood group system is a system of antigens located on this protein. The protein mediates cellular binding to particles and immune complexes that have activated complement. Decreases in expression of this protein and/or mutations in its gene have been associated with gallbladder carcinomas, mesangiocapillary glomerulonephritis, systemic lupus erythematosus and sarcoidosis. Mutations in this gene have also been associated with a reduction in Plasmodium falciparum rosetting, conferring protection against severe malaria. Alternate allele-specific splice variants, encoding different isoforms, have been characterized. Additional allele specific isoforms, including a secreted form, have been described but have not been fully characterized. [provided by RefSeq, Jul 2008]
domestic cat(101094393) complement component (3b/4b) receptor 1 (Knops blood group)
dog(609328) complement component (3b/4b) receptor 1 (Knops blood group)
Domestic Rabbit(100144334) complement component (3b/4b) receptor 1 (Knops blood group)
naked mole-rat(101704987) complement component (3b/4b) receptor 1 (Knops blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000573 Rosetta Predictions human pricing
NM_000651 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107172 predicted 4440
2 SASI_Hs01_00107173 predicted 6306
3 SASI_Hs01_00107174 predicted 4665
4 SASI_Hs01_00107175 predicted 2755
5 SASI_Hs01_00107176 predicted 6154
6 SASI_Hs02_00302821 predicted 1443
7 SASI_Hs01_00107177 predicted 4477
8 SASI_Hs02_00302822 predicted 5349
9 SASI_Hs01_00107178 predicted 2064
10 SASI_Hs01_00107179 predicted 4665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100701 predicted 5787
2 SASI_Hs01_00100702 predicted 7659
3 SASI_Hs01_00100703 predicted 6017
4 SASI_Hs01_00100704 predicted 4112
5 SASI_Hs01_00100706 predicted 7510
6 SASI_Hs02_00303022 predicted 2797
7 SASI_Hs01_00100707 predicted 5830
8 SASI_Hs02_00303023 predicted 6701
9 SASI_Hs01_00100708 predicted 3415
10 SASI_Hs01_00100705 predicted 7169
11 SASI_Hs01_00100709 predicted 6012
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000573
CR1 MISSION shRNA Bacterial Glycerol Stock
complement component (3b/4b) receptor 1 (Knops blood group)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000573.2-6538s1c1
Sequence:CCGGGCCTGGAATTTCTGGTTTGTACTCGAGTACAAACCAGAAATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-1216s1c1
Sequence:CCGGCGTGTGCTATTTCCAGTAAATCTCGAGATTTACTGGAAATAGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-6081s1c1
Sequence:CCGGCCTCTCTTGGATAATTCTAAACTCGAGTTTAGAATTATCCAAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-3282s1c1
Sequence:CCGGGCCGCCAATTTGTCAACGAATCTCGAGATTCGTTGACAAATTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-4858s1c1
Sequence:CCGGCCTCGGTGTATTTCTACTAATCTCGAGATTAGTAGAAATACACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000573
CR1 MISSION shRNA shRNA Plasmid DNA
complement component (3b/4b) receptor 1 (Knops blood group)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000573.2-6538s1c1
Sequence:CCGGGCCTGGAATTTCTGGTTTGTACTCGAGTACAAACCAGAAATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-1216s1c1
Sequence:CCGGCGTGTGCTATTTCCAGTAAATCTCGAGATTTACTGGAAATAGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-6081s1c1
Sequence:CCGGCCTCTCTTGGATAATTCTAAACTCGAGTTTAGAATTATCCAAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-3282s1c1
Sequence:CCGGGCCGCCAATTTGTCAACGAATCTCGAGATTCGTTGACAAATTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-4858s1c1
Sequence:CCGGCCTCGGTGTATTTCTACTAATCTCGAGATTAGTAGAAATACACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000573
CR1 MISSION shRNA Lentiviral Transduction Particles
complement component (3b/4b) receptor 1 (Knops blood group)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000573.2-6538s1c1
Sequence:CCGGGCCTGGAATTTCTGGTTTGTACTCGAGTACAAACCAGAAATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-1216s1c1
Sequence:CCGGCGTGTGCTATTTCCAGTAAATCTCGAGATTTACTGGAAATAGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-6081s1c1
Sequence:CCGGCCTCTCTTGGATAATTCTAAACTCGAGTTTAGAATTATCCAAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-3282s1c1
Sequence:CCGGGCCGCCAATTTGTCAACGAATCTCGAGATTCGTTGACAAATTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000573.2-4858s1c1
Sequence:CCGGCCTCGGTGTATTTCTACTAATCTCGAGATTAGTAGAAATACACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks