EMAIL THIS PAGE TO A FRIEND

CR1L

complement component (3b/4b) receptor 1-like

163 Gene Product Result for
UniProtKB ID: Q2VPA4, Q32MC9, Q8NEU7
Gene ID:
Mouse(12946) complement component (3b/4b) receptor 1-like
Rat(54243) complement component (3b/4b) receptor 1-like
chicken(419853) complement component (3b/4b) receptor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301595 ANTI-CR1L (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175710 Rosetta Predictions human pricing
XM_114735 Rosetta Predictions human pricing
XM_931252 Rosetta Predictions human pricing
XM_931256 Rosetta Predictions human pricing
NM_001005265 Rosetta Predictions rat pricing
NM_001005330 Rosetta Predictions rat pricing
NM_019301 Rosetta Predictions rat pricing
NM_013499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369032 predicted 1521
2 SASI_Hs02_00369033 predicted 1092
3 SASI_Hs02_00369034 predicted 519
4 SASI_Hs02_00369035 predicted 1337
5 SASI_Hs02_00369036 predicted 1740
6 SASI_Hs02_00369037 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_114735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265227 predicted 1039
2 SASI_Hs01_00265228 predicted 1050
3 SASI_Hs01_00265229 predicted 1034
4 SASI_Hs01_00265230 predicted 1048
5 SASI_Hs01_00265231 predicted 1052
6 SASI_Hs01_00265232 predicted 1043
7 SASI_Hs01_00265233 predicted 871
8 SASI_Hs01_00265234 predicted 1050
9 SASI_Hs01_00265235 predicted 483
10 SASI_Hs01_00265236 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261605 predicted 325
2 SASI_Hs01_00261606 predicted 322
3 SASI_Hs01_00261607 predicted 165
4 SASI_Hs01_00261608 predicted 328
5 SASI_Hs01_00261609 predicted 483
6 SASI_Hs01_00261610 predicted 348
7 SASI_Hs01_00261611 predicted 341
8 SASI_Hs01_00261612 predicted 497
9 SASI_Hs01_00261613 predicted 492
10 SASI_Hs01_00261614 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258023 predicted 356
2 SASI_Hs01_00258024 predicted 220
3 SASI_Hs01_00258025 predicted 209
4 SASI_Hs01_00258026 predicted 361
5 SASI_Hs01_00258027 predicted 222
6 SASI_Hs01_00258028 predicted 196
7 SASI_Hs01_00258029 predicted 573
8 SASI_Hs01_00258030 predicted 570
9 SASI_Hs01_00258031 predicted 370
10 SASI_Hs01_00258032 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042448 predicted 419
2 SASI_Rn01_00042449 predicted 1068
3 SASI_Rn01_00042450 predicted 1590
4 SASI_Rn01_00042451 predicted 606
5 SASI_Rn01_00042452 predicted 1614
6 SASI_Rn01_00042453 predicted 611
7 SASI_Rn01_00042454 predicted 484
8 SASI_Rn01_00042455 predicted 722
9 SASI_Rn01_00042456 predicted 707
10 SASI_Rn01_00042457 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198358 predicted 1240
2 SASI_Rn01_00103570 predicted 414
3 SASI_Rn01_00103571 predicted 1070
4 SASI_Rn02_00198359 predicted 1710
5 SASI_Rn01_00103572 predicted 1969
6 SASI_Rn01_00103574 predicted 1989
7 SASI_Rn02_00198360 predicted 1203
8 SASI_Rn01_00103575 predicted 618
9 SASI_Rn02_00198361 predicted 1213
10 SASI_Rn01_00103576 predicted 481
11 SASI_Rn01_00103573 predicted 613
12 SASI_Rn01_00103577 predicted 727
13 SASI_Rn01_00103578 predicted 712
14 SASI_Rn01_00103579 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121108 predicted 413
2 SASI_Rn01_00121109 predicted 1069
3 SASI_Rn01_00121110 predicted 1776
4 SASI_Rn01_00121111 predicted 611
5 SASI_Rn01_00121112 predicted 1802
6 SASI_Rn01_00121113 predicted 615
7 SASI_Rn01_00121114 predicted 487
8 SASI_Rn01_00121115 predicted 723
9 SASI_Rn01_00121116 predicted 704
10 SASI_Rn01_00121117 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125659 predicted 906
2 SASI_Mm01_00125660 predicted 631
3 SASI_Mm01_00125661 predicted 1347
4 SASI_Mm01_00125663 predicted 746
5 SASI_Mm01_00125664 predicted 722
6 SASI_Mm01_00125665 predicted 499
7 SASI_Mm01_00125666 predicted 453
8 SASI_Mm01_00125667 predicted 1116
9 SASI_Mm02_00322149 predicted 994
10 SASI_Mm02_00322150 predicted 827
11 SASI_Mm01_00125662 predicted 1135
12 SASI_Mm01_00125668 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013499
VALIDATED
CR1L MISSION shRNA Bacterial Glycerol Stock
complement component (3b/4b) receptor 1-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013499.2-540s1c1
Sequence:CCGGCGAGTGCTGAAGATAAGTGTACTCGAGTACACTTATCTTCAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-780s1c1
Sequence:CCGGCCAATGGAGATTTCTTCAGTTCTCGAGAACTGAAGAAATCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013499.2-1227s1c1
Sequence:CCGGGAGAGAATGTAACCTTGGAATCTCGAGATTCCAAGGTTACATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-775s1c1
Sequence:CCGGCATTCCCAATGGAGATTTCTTCTCGAGAAGAAATCTCCATTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-1337s1c1
Sequence:CCGGCGCTCAATCAGTGGTCTAATTCTCGAGAATTAGACCACTGATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-723s21c1
Sequence:CCGGGGGATACTGAGGCACCTATTTCTCGAGAAATAGGTGCCTCAGTATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-1455s21c1
Sequence:CCGGAGTATAAAGAAGTGGGTATTCCTCGAGGAATACCCACTTCTTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-859s21c1
Sequence:CCGGGAGAGGGAAGGCGCTCTTTAACTCGAGTTAAAGAGCGCCTTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-448s21c1
Sequence:CCGGGTTTCCCATTGGAACATATTTCTCGAGAAATATGTTCCAATGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013499
VALIDATED
CR1L MISSION shRNA shRNA Plasmid DNA
complement component (3b/4b) receptor 1-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013499.2-540s1c1
Sequence:CCGGCGAGTGCTGAAGATAAGTGTACTCGAGTACACTTATCTTCAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-780s1c1
Sequence:CCGGCCAATGGAGATTTCTTCAGTTCTCGAGAACTGAAGAAATCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013499.2-1227s1c1
Sequence:CCGGGAGAGAATGTAACCTTGGAATCTCGAGATTCCAAGGTTACATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-775s1c1
Sequence:CCGGCATTCCCAATGGAGATTTCTTCTCGAGAAGAAATCTCCATTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-1337s1c1
Sequence:CCGGCGCTCAATCAGTGGTCTAATTCTCGAGAATTAGACCACTGATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-723s21c1
Sequence:CCGGGGGATACTGAGGCACCTATTTCTCGAGAAATAGGTGCCTCAGTATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-1455s21c1
Sequence:CCGGAGTATAAAGAAGTGGGTATTCCTCGAGGAATACCCACTTCTTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-859s21c1
Sequence:CCGGGAGAGGGAAGGCGCTCTTTAACTCGAGTTAAAGAGCGCCTTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-448s21c1
Sequence:CCGGGTTTCCCATTGGAACATATTTCTCGAGAAATATGTTCCAATGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013499
VALIDATED
CR1L MISSION shRNA Lentiviral Transduction Particles
complement component (3b/4b) receptor 1-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013499.2-540s1c1
Sequence:CCGGCGAGTGCTGAAGATAAGTGTACTCGAGTACACTTATCTTCAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-780s1c1
Sequence:CCGGCCAATGGAGATTTCTTCAGTTCTCGAGAACTGAAGAAATCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013499.2-1227s1c1
Sequence:CCGGGAGAGAATGTAACCTTGGAATCTCGAGATTCCAAGGTTACATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-775s1c1
Sequence:CCGGCATTCCCAATGGAGATTTCTTCTCGAGAAGAAATCTCCATTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013499.2-1337s1c1
Sequence:CCGGCGCTCAATCAGTGGTCTAATTCTCGAGAATTAGACCACTGATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-723s21c1
Sequence:CCGGGGGATACTGAGGCACCTATTTCTCGAGAAATAGGTGCCTCAGTATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-1455s21c1
Sequence:CCGGAGTATAAAGAAGTGGGTATTCCTCGAGGAATACCCACTTCTTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-859s21c1
Sequence:CCGGGAGAGGGAAGGCGCTCTTTAACTCGAGTTAAAGAGCGCCTTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013499.2-448s21c1
Sequence:CCGGGTTTCCCATTGGAACATATTTCTCGAGAAATATGTTCCAATGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175710
CR1L MISSION shRNA Bacterial Glycerol Stock
complement component (3b/4b) receptor 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-573s21c1
Sequence:CCGGCTGTTTGTGACAGAATTATTTCTCGAGAAATAATTCTGTCACAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-1335s21c1
Sequence:CCGGTTCCAGTGTGTGAACGTAAATCTCGAGATTTACGTTCACACACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-1090s21c1
Sequence:CCGGCCTCAGAGGATCTACGTATTTCTCGAGAAATACGTAGATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-631s21c1
Sequence:CCGGTAGCATCAGCAGAGAGTATTTCTCGAGAAATACTCTCTGCTGATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-205s21c1
Sequence:CCGGGTCCTCCTTCTCCGATCAATGCTCGAGCATTGATCGGAGAAGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175710
CR1L MISSION shRNA shRNA Plasmid DNA
complement component (3b/4b) receptor 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-573s21c1
Sequence:CCGGCTGTTTGTGACAGAATTATTTCTCGAGAAATAATTCTGTCACAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-1335s21c1
Sequence:CCGGTTCCAGTGTGTGAACGTAAATCTCGAGATTTACGTTCACACACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-1090s21c1
Sequence:CCGGCCTCAGAGGATCTACGTATTTCTCGAGAAATACGTAGATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-631s21c1
Sequence:CCGGTAGCATCAGCAGAGAGTATTTCTCGAGAAATACTCTCTGCTGATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-205s21c1
Sequence:CCGGGTCCTCCTTCTCCGATCAATGCTCGAGCATTGATCGGAGAAGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175710
CR1L MISSION shRNA Lentiviral Transduction Particles
complement component (3b/4b) receptor 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-573s21c1
Sequence:CCGGCTGTTTGTGACAGAATTATTTCTCGAGAAATAATTCTGTCACAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-1335s21c1
Sequence:CCGGTTCCAGTGTGTGAACGTAAATCTCGAGATTTACGTTCACACACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-1090s21c1
Sequence:CCGGCCTCAGAGGATCTACGTATTTCTCGAGAAATACGTAGATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-631s21c1
Sequence:CCGGTAGCATCAGCAGAGAGTATTTCTCGAGAAATACTCTCTGCTGATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175710.1-205s21c1
Sequence:CCGGGTCCTCCTTCTCCGATCAATGCTCGAGCATTGATCGGAGAAGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks