EMAIL THIS PAGE TO A FRIEND

CR2

complement component (3d/Epstein Barr virus) receptor 2

Synonyms: C3DR CD21 CR CVID7 SLEB9
Gene ID:
Human(1380) Summary: This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(12902) complement receptor 2
Rat(289395) complement component (3d/Epstein Barr virus) receptor 2
sheep(443017) complement component (3d/Epstein Barr virus) receptor 2
domestic guinea pig(101787675) complement component (3d/Epstein Barr virus) receptor 2
chicken(419854) complement component (3d/Epstein Barr virus) receptor 2
cow(407126) complement component (3d/Epstein Barr virus) receptor 2
dog(490269) complement component (3d/Epstein Barr virus) receptor 2
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1325 Human CD21 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006658 Rosetta Predictions human pricing
NM_001877 Rosetta Predictions human pricing
NM_001105989 Rosetta Predictions rat pricing
NM_007758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047125 predicted 224
2 SASI_Hs01_00047127 predicted 2632
3 SASI_Hs01_00047129 predicted 1192
4 SASI_Hs01_00047130 predicted 3055
5 SASI_Hs01_00047133 predicted 761
6 SASI_Hs02_00305122 predicted 1560
7 SASI_Hs01_00047134 predicted 570
8 SASI_Hs02_00305123 predicted 983
9 SASI_Hs02_00305124 predicted 1154
10 SASI_Hs02_00305125 predicted 747
11 SASI_Hs01_00047126 predicted 3441
12 SASI_Hs01_00047128 predicted 572
13 SASI_Hs01_00047131 predicted 1821
14 SASI_Hs01_00047132 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056445 predicted 220
2 SASI_Hs01_00056447 predicted 2450
3 SASI_Hs01_00056449 predicted 1195
4 SASI_Hs01_00056450 predicted 2884
5 SASI_Hs01_00056453 predicted 766
6 SASI_Hs02_00332726 predicted 1563
7 SASI_Hs01_00056454 predicted 571
8 SASI_Hs02_00332727 predicted 987
9 SASI_Hs02_00332728 predicted 1156
10 SASI_Hs02_00332729 predicted 748
11 SASI_Hs01_00056446 predicted 3263
12 SASI_Hs01_00056448 predicted 566
13 SASI_Hs01_00056451 predicted 1813
14 SASI_Hs01_00056452 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214532 predicted 2482
2 SASI_Rn02_00214533 predicted 2955
3 SASI_Rn02_00214534 predicted 609
4 SASI_Rn02_00214535 predicted 1404
5 SASI_Rn02_00214536 predicted 996
6 SASI_Rn02_00214537 predicted 3023
7 SASI_Rn02_00214538 predicted 2072
8 SASI_Rn02_00214539 predicted 2518
9 SASI_Rn02_00214540 predicted 291
10 SASI_Rn02_00214541 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104762 predicted 1552
2 SASI_Mm02_00312378 predicted 3273
3 SASI_Mm01_00104763 predicted 2931
4 SASI_Mm01_00104764 predicted 902
5 SASI_Mm01_00104765 predicted 222
6 SASI_Mm01_00104766 predicted 838
7 SASI_Mm01_00104767 predicted 2571
8 SASI_Mm02_00312379 predicted 1599
9 SASI_Mm01_00104769 predicted 334
10 SASI_Mm01_00104770 predicted 407
11 SASI_Mm01_00104768 predicted 2548
12 SASI_Mm01_00104771 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007758
CR2 MISSION shRNA Bacterial Glycerol Stock
complement component (3d/Epstein Barr virus) receptor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007758.2-3278s21c1
Sequence:CCGGAGCTACCCTCCACGACAATAACTCGAGTTATTGTCGTGGAGGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007758.2-3047s21c1
Sequence:CCGGTGGGCTCAGCACTTATCATTTCTCGAGAAATGATAAGTGCTGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007758.2-573s21c1
Sequence:CCGGATCACTTCCAACGATTCATAACTCGAGTTATGAATCGTTGGAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-2576s1c1
Sequence:CCGGGCCACTTGATAAGGTGTCATACTCGAGTATGACACCTTATCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-208s1c1
Sequence:CCGGCCCTATTATTCTCTTCCCATACTCGAGTATGGGAAGAGAATAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-1913s1c1
Sequence:CCGGGCACAGACGTTCATGTTGAAACTCGAGTTTCAACATGAACGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-3078s1c1
Sequence:CCGGCGGCTTCTGTATGATATTAAACTCGAGTTTAATATCATACAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-1398s1c1
Sequence:CCGGCCCTGGTACATCCATAAGATACTCGAGTATCTTATGGATGTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007758
CR2 MISSION shRNA shRNA Plasmid DNA
complement component (3d/Epstein Barr virus) receptor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007758.2-3278s21c1
Sequence:CCGGAGCTACCCTCCACGACAATAACTCGAGTTATTGTCGTGGAGGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007758.2-3047s21c1
Sequence:CCGGTGGGCTCAGCACTTATCATTTCTCGAGAAATGATAAGTGCTGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007758.2-573s21c1
Sequence:CCGGATCACTTCCAACGATTCATAACTCGAGTTATGAATCGTTGGAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-2576s1c1
Sequence:CCGGGCCACTTGATAAGGTGTCATACTCGAGTATGACACCTTATCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-208s1c1
Sequence:CCGGCCCTATTATTCTCTTCCCATACTCGAGTATGGGAAGAGAATAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-1913s1c1
Sequence:CCGGGCACAGACGTTCATGTTGAAACTCGAGTTTCAACATGAACGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-3078s1c1
Sequence:CCGGCGGCTTCTGTATGATATTAAACTCGAGTTTAATATCATACAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-1398s1c1
Sequence:CCGGCCCTGGTACATCCATAAGATACTCGAGTATCTTATGGATGTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007758
CR2 MISSION shRNA Lentiviral Transduction Particles
complement component (3d/Epstein Barr virus) receptor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007758.2-3278s21c1
Sequence:CCGGAGCTACCCTCCACGACAATAACTCGAGTTATTGTCGTGGAGGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007758.2-3047s21c1
Sequence:CCGGTGGGCTCAGCACTTATCATTTCTCGAGAAATGATAAGTGCTGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007758.2-573s21c1
Sequence:CCGGATCACTTCCAACGATTCATAACTCGAGTTATGAATCGTTGGAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-2576s1c1
Sequence:CCGGGCCACTTGATAAGGTGTCATACTCGAGTATGACACCTTATCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-208s1c1
Sequence:CCGGCCCTATTATTCTCTTCCCATACTCGAGTATGGGAAGAGAATAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-1913s1c1
Sequence:CCGGGCACAGACGTTCATGTTGAAACTCGAGTTTCAACATGAACGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-3078s1c1
Sequence:CCGGCGGCTTCTGTATGATATTAAACTCGAGTTTAATATCATACAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007758.1-1398s1c1
Sequence:CCGGCCCTGGTACATCCATAAGATACTCGAGTATCTTATGGATGTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006658
CR2 MISSION shRNA Bacterial Glycerol Stock
complement component (3d/Epstein Barr virus) receptor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006658.1-3557s1c1
Sequence:CCGGGCCCAGTTTCACTGCCATATACTCGAGTATATGGCAGTGAAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-2551s1c1
Sequence:CCGGGCAGTGCAGAAGTGATTCTAACTCGAGTTAGAATCACTTCTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-2983s1c1
Sequence:CCGGCCCTCATTGTAAAGAGGTAAACTCGAGTTTACCTCTTTACAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-3278s1c1
Sequence:CCGGGCACGCAATTATTATACAGATCTCGAGATCTGTATAATAATTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-189s1c1
Sequence:CCGGGCCGGATTAGTTATTATTCTACTCGAGTAGAATAATAACTAATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006658
CR2 MISSION shRNA shRNA Plasmid DNA
complement component (3d/Epstein Barr virus) receptor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006658.1-3557s1c1
Sequence:CCGGGCCCAGTTTCACTGCCATATACTCGAGTATATGGCAGTGAAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-2551s1c1
Sequence:CCGGGCAGTGCAGAAGTGATTCTAACTCGAGTTAGAATCACTTCTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-2983s1c1
Sequence:CCGGCCCTCATTGTAAAGAGGTAAACTCGAGTTTACCTCTTTACAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-3278s1c1
Sequence:CCGGGCACGCAATTATTATACAGATCTCGAGATCTGTATAATAATTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-189s1c1
Sequence:CCGGGCCGGATTAGTTATTATTCTACTCGAGTAGAATAATAACTAATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006658
CR2 MISSION shRNA Lentiviral Transduction Particles
complement component (3d/Epstein Barr virus) receptor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006658.1-3557s1c1
Sequence:CCGGGCCCAGTTTCACTGCCATATACTCGAGTATATGGCAGTGAAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-2551s1c1
Sequence:CCGGGCAGTGCAGAAGTGATTCTAACTCGAGTTAGAATCACTTCTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-2983s1c1
Sequence:CCGGCCCTCATTGTAAAGAGGTAAACTCGAGTTTACCTCTTTACAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-3278s1c1
Sequence:CCGGGCACGCAATTATTATACAGATCTCGAGATCTGTATAATAATTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006658.1-189s1c1
Sequence:CCGGGCCGGATTAGTTATTATTCTACTCGAGTAGAATAATAACTAATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks