EMAIL THIS PAGE TO A FRIEND

CRABP1

cellular retinoic acid binding protein 1

51 Gene Product Result for
Synonyms: CRABP CRABP-I CRABPI RBP5
UniProtKB ID: P29762, Q6IAY7, Q8WTV5
Gene ID:
Human(1381) Summary: This gene encodes a specific binding protein for a vitamin A family member and is thought to play an important role in retinoic acid-mediated differentiation and proliferation processes. It is structurally similar to the cellular retinol-binding proteins, but binds only retinoic acid at specific sites within the nucleus, which may contribute to vitamin A-directed differentiation in epithelial tissue. [provided by RefSeq, Jul 2008]
Mouse(12903) cellular retinoic acid binding protein I
Rat(25061) cellular retinoic acid binding protein 1
chicken(374211) cellular retinoic acid binding protein 1
dog(610253) cellular retinoic acid binding protein 1
domestic cat(101090941) cellular retinoic acid binding protein 1
cow(282201) cellular retinoic acid binding protein 1
domestic guinea pig(100720673) cellular retinoic acid binding protein 1
naked mole-rat(101703381) cellular retinoic acid binding protein 1
sheep(101122057) cellular retinoic acid binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004378 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004378 Rosetta Predictions human pricing
NM_001105716 Rosetta Predictions rat pricing
NM_013496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205776 predicted 400
2 SASI_Hs01_00205777 predicted 407
3 SASI_Hs02_00337464 predicted 304
4 SASI_Hs01_00205778 predicted 300
5 SASI_Hs01_00205779 predicted 302
6 SASI_Hs01_00205780 predicted 401
7 SASI_Hs01_00205782 predicted 312
8 SASI_Hs01_00205783 predicted 405
9 SASI_Hs01_00205784 predicted 281
10 SASI_Hs02_00337465 predicted 349
11 SASI_Hs01_00205775 predicted 357
12 SASI_Hs01_00205781 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211826 predicted 514
2 SASI_Rn02_00211827 predicted 492
3 SASI_Rn02_00211828 predicted 481
4 SASI_Rn02_00211829 predicted 474
5 SASI_Rn02_00211830 predicted 480
6 SASI_Rn02_00211831 predicted 333
7 SASI_Rn02_00211832 predicted 473
8 SASI_Rn02_00211833 predicted 464
9 SASI_Rn02_00211834 predicted 247
10 SASI_Rn02_00211835 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165634 predicted 431
2 SASI_Mm01_00165635 predicted 320
3 SASI_Mm01_00165636 predicted 480
4 SASI_Mm01_00165637 predicted 462
5 SASI_Mm01_00165638 predicted 312
6 SASI_Mm01_00165639 predicted 335
7 SASI_Mm01_00165640 predicted 335
8 SASI_Mm01_00165641 predicted 453
9 SASI_Mm01_00165642 predicted 299
10 SASI_Mm01_00165643 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004378
CRABP1 MISSION shRNA Bacterial Glycerol Stock
cellular retinoic acid binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-466s1c1
Sequence:CCGGCCAGAATTTATGTCCGGGAATCTCGAGATTCCCGGACATAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-422s1c1
Sequence:CCGGCGATGAACTTATCCTGACGTTCTCGAGAACGTCAGGATAAGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-360s1c1
Sequence:CCGGTGCACCCAAACTCTTCTTGAACTCGAGTTCAAGAAGAGTTTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-413s1c1
Sequence:CCGGGCTGGCCAACGATGAACTTATCTCGAGATAAGTTCATCGTTGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-308s1c1
Sequence:CCGGCGGACGCAAGTGCAGGAGTTTCTCGAGAAACTCCTGCACTTGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-381s21c1
Sequence:CCGGCAAGATCCACTGCACGCAAACCTCGAGGTTTGCGTGCAGTGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-295s21c1
Sequence:CCGGATCAACTTCAAGGTCGGAGAACTCGAGTTCTCCGACCTTGAAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004378.2-566s21c1
Sequence:CCGGTGAGGAATATGTCATAGTTCTCTCGAGAGAACTATGACATATTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-483s21c1
Sequence:CCGGTGACGTGGTCTGCACCAGAATCTCGAGATTCTGGTGCAGACCACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004378
CRABP1 MISSION shRNA shRNA Plasmid DNA
cellular retinoic acid binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-466s1c1
Sequence:CCGGCCAGAATTTATGTCCGGGAATCTCGAGATTCCCGGACATAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-422s1c1
Sequence:CCGGCGATGAACTTATCCTGACGTTCTCGAGAACGTCAGGATAAGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-360s1c1
Sequence:CCGGTGCACCCAAACTCTTCTTGAACTCGAGTTCAAGAAGAGTTTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-413s1c1
Sequence:CCGGGCTGGCCAACGATGAACTTATCTCGAGATAAGTTCATCGTTGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-308s1c1
Sequence:CCGGCGGACGCAAGTGCAGGAGTTTCTCGAGAAACTCCTGCACTTGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-381s21c1
Sequence:CCGGCAAGATCCACTGCACGCAAACCTCGAGGTTTGCGTGCAGTGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-295s21c1
Sequence:CCGGATCAACTTCAAGGTCGGAGAACTCGAGTTCTCCGACCTTGAAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004378.2-566s21c1
Sequence:CCGGTGAGGAATATGTCATAGTTCTCTCGAGAGAACTATGACATATTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-483s21c1
Sequence:CCGGTGACGTGGTCTGCACCAGAATCTCGAGATTCTGGTGCAGACCACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004378
CRABP1 MISSION shRNA Lentiviral Transduction Particles
cellular retinoic acid binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-466s1c1
Sequence:CCGGCCAGAATTTATGTCCGGGAATCTCGAGATTCCCGGACATAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-422s1c1
Sequence:CCGGCGATGAACTTATCCTGACGTTCTCGAGAACGTCAGGATAAGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-360s1c1
Sequence:CCGGTGCACCCAAACTCTTCTTGAACTCGAGTTCAAGAAGAGTTTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-413s1c1
Sequence:CCGGGCTGGCCAACGATGAACTTATCTCGAGATAAGTTCATCGTTGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004378.1-308s1c1
Sequence:CCGGCGGACGCAAGTGCAGGAGTTTCTCGAGAAACTCCTGCACTTGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-381s21c1
Sequence:CCGGCAAGATCCACTGCACGCAAACCTCGAGGTTTGCGTGCAGTGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-295s21c1
Sequence:CCGGATCAACTTCAAGGTCGGAGAACTCGAGTTCTCCGACCTTGAAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004378.2-566s21c1
Sequence:CCGGTGAGGAATATGTCATAGTTCTCTCGAGAGAACTATGACATATTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004378.2-483s21c1
Sequence:CCGGTGACGTGGTCTGCACCAGAATCTCGAGATTCTGGTGCAGACCACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013496
VALIDATED
CRABP1 MISSION shRNA Bacterial Glycerol Stock
cellular retinoic acid binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-583s1c1
Sequence:CCGGAGTGGGTCTTTACTCCACACACTCGAGTGTGTGGAGTAAAGACCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013496.1-484s1c1
Sequence:CCGGCACAAGAATTTATGTCCGGGACTCGAGTCCCGGACATAAATTCTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-246s1c1
Sequence:CCGGTCTACATCAAGACATCCACTACTCGAGTAGTGGATGTCTTGATGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-442s1c1
Sequence:CCGGCGATGAGCTAATCCTGACATTCTCGAGAATGTCAGGATTAGCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-328s1c1
Sequence:CCGGCGGACGCAAATGCAGGAGTTTCTCGAGAAACTCCTGCATTTGCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-328s21c1
Sequence:CCGGCGGACGCAAATGCAGGAGTTTCTCGAGAAACTCCTGCATTTGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-246s21c1
Sequence:CCGGTCTACATCAAGACATCCACTACTCGAGTAGTGGATGTCTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013496.2-583s21c1
Sequence:CCGGAGTGGGTCTTTACTCCACACACTCGAGTGTGTGGAGTAAAGACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-442s21c1
Sequence:CCGGCGATGAGCTAATCCTGACATTCTCGAGAATGTCAGGATTAGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013496
VALIDATED
CRABP1 MISSION shRNA shRNA Plasmid DNA
cellular retinoic acid binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-583s1c1
Sequence:CCGGAGTGGGTCTTTACTCCACACACTCGAGTGTGTGGAGTAAAGACCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013496.1-484s1c1
Sequence:CCGGCACAAGAATTTATGTCCGGGACTCGAGTCCCGGACATAAATTCTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-246s1c1
Sequence:CCGGTCTACATCAAGACATCCACTACTCGAGTAGTGGATGTCTTGATGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-442s1c1
Sequence:CCGGCGATGAGCTAATCCTGACATTCTCGAGAATGTCAGGATTAGCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-328s1c1
Sequence:CCGGCGGACGCAAATGCAGGAGTTTCTCGAGAAACTCCTGCATTTGCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-328s21c1
Sequence:CCGGCGGACGCAAATGCAGGAGTTTCTCGAGAAACTCCTGCATTTGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-246s21c1
Sequence:CCGGTCTACATCAAGACATCCACTACTCGAGTAGTGGATGTCTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013496.2-583s21c1
Sequence:CCGGAGTGGGTCTTTACTCCACACACTCGAGTGTGTGGAGTAAAGACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-442s21c1
Sequence:CCGGCGATGAGCTAATCCTGACATTCTCGAGAATGTCAGGATTAGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013496
VALIDATED
CRABP1 MISSION shRNA Lentiviral Transduction Particles
cellular retinoic acid binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-583s1c1
Sequence:CCGGAGTGGGTCTTTACTCCACACACTCGAGTGTGTGGAGTAAAGACCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013496.1-484s1c1
Sequence:CCGGCACAAGAATTTATGTCCGGGACTCGAGTCCCGGACATAAATTCTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-246s1c1
Sequence:CCGGTCTACATCAAGACATCCACTACTCGAGTAGTGGATGTCTTGATGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-442s1c1
Sequence:CCGGCGATGAGCTAATCCTGACATTCTCGAGAATGTCAGGATTAGCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013496.1-328s1c1
Sequence:CCGGCGGACGCAAATGCAGGAGTTTCTCGAGAAACTCCTGCATTTGCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-328s21c1
Sequence:CCGGCGGACGCAAATGCAGGAGTTTCTCGAGAAACTCCTGCATTTGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-246s21c1
Sequence:CCGGTCTACATCAAGACATCCACTACTCGAGTAGTGGATGTCTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013496.2-583s21c1
Sequence:CCGGAGTGGGTCTTTACTCCACACACTCGAGTGTGTGGAGTAAAGACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013496.2-442s21c1
Sequence:CCGGCGATGAGCTAATCCTGACATTCTCGAGAATGTCAGGATTAGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks