EMAIL THIS PAGE TO A FRIEND

CRABP2

cellular retinoic acid binding protein 2

57 Gene Product Result for
Synonyms: CRABP-II RBP6
UniProtKB ID: P29373, B2R4Z8, D3DVC5, F1T098, Q6ICN6
Gene ID:
Human(1382) Summary: This gene encodes a member of the retinoic acid (RA, a form of vitamin A) binding protein family and lipocalin/cytosolic fatty-acid binding protein family. The protein is a cytosol-to-nuclear shuttling protein, which facilitates RA binding to its cognate receptor complex and transfer to the nucleus. It is involved in the retinoid signaling pathway, and is associated with increased circulating low-density lipoprotein cholesterol. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2010]
Mouse(12904) cellular retinoic acid binding protein II
Rat(29563) cellular retinoic acid binding protein 2
cow(493998) cellular retinoic acid binding protein 2
domestic cat(101082543) cellular retinoic acid binding protein 2
dog(612093) cellular retinoic acid binding protein 2
sheep(101106810) cellular retinoic acid binding protein 2
naked mole-rat(101720307) cellular retinoic acid binding protein 2
domestic guinea pig(100724780) cellular retinoic acid binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001878 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001878 Rosetta Predictions human pricing
NM_017244 Rosetta Predictions rat pricing
NM_007759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332730 predicted 635
2 SASI_Hs01_00189858 predicted 382
3 SASI_Hs01_00189859 predicted 254
4 SASI_Hs01_00189860 predicted 317
5 SASI_Hs01_00189862 predicted 526
6 SASI_Hs01_00189863 predicted 363
7 SASI_Hs01_00189864 predicted 273
8 SASI_Hs01_00189865 predicted 499
9 SASI_Hs01_00189866 predicted 691
10 SASI_Hs01_00189867 predicted 491
11 SASI_Hs01_00189861 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041005 predicted 255
2 SASI_Rn01_00041006 predicted 527
3 SASI_Rn01_00041007 predicted 285
4 SASI_Rn01_00041008 predicted 510
5 SASI_Rn01_00041009 predicted 503
6 SASI_Rn02_00261621 predicted 334
7 SASI_Rn01_00041010 predicted 453
8 SASI_Rn01_00041011 predicted 351
9 SASI_Rn01_00041013 predicted 243
10 SASI_Rn01_00041014 predicted 455
11 SASI_Rn01_00041012 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312380 predicted 497
2 SASI_Mm01_00117287 predicted 493
3 SASI_Mm01_00117290 predicted 545
4 SASI_Mm01_00117294 predicted 561
5 SASI_Mm01_00117295 predicted 264
6 SASI_Mm01_00117296 predicted 483
7 SASI_Mm02_00312381 predicted 554
8 SASI_Mm02_00312382 predicted 487
9 SASI_Mm02_00312383 predicted 265
10 SASI_Mm02_00312384 predicted 330
11 SASI_Mm01_00117288 predicted 674
12 SASI_Mm01_00117289 predicted 325
13 SASI_Mm01_00117291 predicted 323
14 SASI_Mm01_00117292 predicted 408
15 SASI_Mm01_00117293 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001878
VALIDATED
CRABP2 MISSION shRNA Bacterial Glycerol Stock
cellular retinoic acid binding protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-185s21c1
Sequence:CCGGCGAGGAATTGCTCAAAGTGCTCTCGAGAGCACTTTGAGCAATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-321s21c1
Sequence:CCGGACAGAGATTAACTTCAAGGTTCTCGAGAACCTTGAAGTTAATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-395s21c1
Sequence:CCGGGAAATGGGAGAGTGAGAATAACTCGAGTTATTCTCACTCTCCCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-268s21c1
Sequence:CCGGTCAAACAGGAGGGAGACACTTCTCGAGAAGTGTCTCCCTCCTGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001878.2-321s1c1
Sequence:CCGGACAGAGATTAACTTCAAGGTTCTCGAGAACCTTGAAGTTAATCTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-395s1c1
Sequence:CCGGGAAATGGGAGAGTGAGAATAACTCGAGTTATTCTCACTCTCCCATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-268s1c1
Sequence:CCGGTCAAACAGGAGGGAGACACTTCTCGAGAAGTGTCTCCCTCCTGTTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-185s1c1
Sequence:CCGGCGAGGAATTGCTCAAAGTGCTCTCGAGAGCACTTTGAGCAATTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001878
VALIDATED
CRABP2 MISSION shRNA shRNA Plasmid DNA
cellular retinoic acid binding protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-185s21c1
Sequence:CCGGCGAGGAATTGCTCAAAGTGCTCTCGAGAGCACTTTGAGCAATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-321s21c1
Sequence:CCGGACAGAGATTAACTTCAAGGTTCTCGAGAACCTTGAAGTTAATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-395s21c1
Sequence:CCGGGAAATGGGAGAGTGAGAATAACTCGAGTTATTCTCACTCTCCCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-268s21c1
Sequence:CCGGTCAAACAGGAGGGAGACACTTCTCGAGAAGTGTCTCCCTCCTGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001878.2-321s1c1
Sequence:CCGGACAGAGATTAACTTCAAGGTTCTCGAGAACCTTGAAGTTAATCTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-395s1c1
Sequence:CCGGGAAATGGGAGAGTGAGAATAACTCGAGTTATTCTCACTCTCCCATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-268s1c1
Sequence:CCGGTCAAACAGGAGGGAGACACTTCTCGAGAAGTGTCTCCCTCCTGTTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-185s1c1
Sequence:CCGGCGAGGAATTGCTCAAAGTGCTCTCGAGAGCACTTTGAGCAATTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001878
VALIDATED
CRABP2 MISSION shRNA Lentiviral Transduction Particles
cellular retinoic acid binding protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-185s21c1
Sequence:CCGGCGAGGAATTGCTCAAAGTGCTCTCGAGAGCACTTTGAGCAATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-321s21c1
Sequence:CCGGACAGAGATTAACTTCAAGGTTCTCGAGAACCTTGAAGTTAATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-395s21c1
Sequence:CCGGGAAATGGGAGAGTGAGAATAACTCGAGTTATTCTCACTCTCCCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001878.2-268s21c1
Sequence:CCGGTCAAACAGGAGGGAGACACTTCTCGAGAAGTGTCTCCCTCCTGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001878.2-321s1c1
Sequence:CCGGACAGAGATTAACTTCAAGGTTCTCGAGAACCTTGAAGTTAATCTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-395s1c1
Sequence:CCGGGAAATGGGAGAGTGAGAATAACTCGAGTTATTCTCACTCTCCCATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-268s1c1
Sequence:CCGGTCAAACAGGAGGGAGACACTTCTCGAGAAGTGTCTCCCTCCTGTTTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001878.2-185s1c1
Sequence:CCGGCGAGGAATTGCTCAAAGTGCTCTCGAGAGCACTTTGAGCAATTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007759
CRABP2 MISSION shRNA Bacterial Glycerol Stock
cellular retinoic acid binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007759.1-632s1c1
Sequence:CCGGCCACGTCCATCTTACAAACTACTCGAGTAGTTTGTAAGATGGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-331s1c1
Sequence:CCGGCACGGAGATTAACTTCAAGATCTCGAGATCTTGAAGTTAATCTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-479s1c1
Sequence:CCGGAGCCGAGAACTGACCAATGATCTCGAGATCATTGGTCAGTTCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-406s1c1
Sequence:CCGGGAAATGGGAGAGTGGAAACAACTCGAGTTGTTTCCACTCTCCCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-229s1c1
Sequence:CCGGGATGATGAGGAAGATCGCTGTCTCGAGACAGCGATCTTCCTCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007759
CRABP2 MISSION shRNA shRNA Plasmid DNA
cellular retinoic acid binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007759.1-632s1c1
Sequence:CCGGCCACGTCCATCTTACAAACTACTCGAGTAGTTTGTAAGATGGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-331s1c1
Sequence:CCGGCACGGAGATTAACTTCAAGATCTCGAGATCTTGAAGTTAATCTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-479s1c1
Sequence:CCGGAGCCGAGAACTGACCAATGATCTCGAGATCATTGGTCAGTTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-406s1c1
Sequence:CCGGGAAATGGGAGAGTGGAAACAACTCGAGTTGTTTCCACTCTCCCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-229s1c1
Sequence:CCGGGATGATGAGGAAGATCGCTGTCTCGAGACAGCGATCTTCCTCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007759
CRABP2 MISSION shRNA Lentiviral Transduction Particles
cellular retinoic acid binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007759.1-632s1c1
Sequence:CCGGCCACGTCCATCTTACAAACTACTCGAGTAGTTTGTAAGATGGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-331s1c1
Sequence:CCGGCACGGAGATTAACTTCAAGATCTCGAGATCTTGAAGTTAATCTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-479s1c1
Sequence:CCGGAGCCGAGAACTGACCAATGATCTCGAGATCATTGGTCAGTTCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-406s1c1
Sequence:CCGGGAAATGGGAGAGTGGAAACAACTCGAGTTGTTTCCACTCTCCCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007759.1-229s1c1
Sequence:CCGGGATGATGAGGAAGATCGCTGTCTCGAGACAGCGATCTTCCTCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)